GenePrediction:GLEAN_1542 Details

Name: GLEAN_1542
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:535268..547802 (+ strand)
Length: 12535
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:535268..535328 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_82:535403..535450 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_82:535577..536967 (+ strand)
Length: 1391
Type: CDS
Source: GLEAN
Position: GCSC_82:537066..537393 (+ strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_82:537452..537663 (+ strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_82:537721..544176 (+ strand)
Length: 6456
Type: CDS
Source: GLEAN
Position: GCSC_82:544342..544462 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_82:544623..547626 (+ strand)
Length: 3004
Type: CDS
Source: GLEAN
Position: GCSC_82:547745..547802 (+ strand)
Length: 58
>GLEAN_1542 class=GenePrediction position=GCSC_82:535268..547802 (+ strand)
ATGCCGCCAACGCGGGCGAGAACCGCTGTTGCGGGAGACGCCAGTGCAGAGAGTATCCGTGGTAAGCAATTGGGCAATCA
GCGTGACTGCTTAATCTTGTCCACATCCCCTCACATGCTGATTCGTTTACTATAGCTTCTATCGCCAGTGGAAACTCGAC
TGAGCGGTCTAAAGCTCTGCAAGGTAAGAAATTTGATTAAGCGCATATTACTGTGTGACTAACACTGTTAGAATTGATAT
ACTTCTTTACGAAGAAGTCACAAGGAGCTACACAGTGAGACAAAATATCTCATGATTCGCCTGTTACAGACCAGACACAG
CTGACCAGGAGCAGGCTGTCCCTGGACGCGAAGGCGTATCATAACCTAATAGAAGCCCTGTTCCAGTGTTCTGTCACAGA
AAAAAAGACCTATCTGAGTGGCAAGAGAACTACTAAGACTACCGCTGAGGCAAGGCTTGCGGCAAGTGCAGAAGCATTAC
GGCTAGCCGTAAACTATGGTGCTTCCAGGTTGAAACGCAAGGTGGCGAGGGCGATCGTGGACCACATTACGGAAACACTC
CCTGGACGAGATCTAGAATATGTCGAGCCTCTTCTTCAAGACTACACCAAGGCTCTAGTAGCGCTACTTAGCCACCCCTC
CAATGTCGAGCAGCTTGGTGCTTTTGATGGCGAAGGCTGGCTGGTCTGCGCCGATTTTTTTGCCGAGGCTGTAGACCGTT
TTGCAGAAGTTCCGGATCGCGACACGTTGGCCTTCGGTACATTTTCTCGAGCGTCTCCGGCACCAGGCACTTTACCAAAC
TCCAACTTCTCAGGAAGGTCGGGGTCTATACCCAAACAGCGAACTTCCTCTCAGACATCAAGCAAGATTTTGGAGACGCT
CATGCAAGGACTTCTTTACCTGGTTTCAGCTCCGAATGCACCTCTTAAGTTGAGGGCATCTCAACTGTCACAGGCTGCTA
TTCGAGTGTTGCAACTGCAATACCTGGGCATCGGCCATCTGCAGCAAGCAGCTTTTGCAACCATCAGGTGCATCGTCCAA
AGCGTGAGAGGAGATGACATCTGCTTGGTAGAAGGCATTGCGCGAGAAGTCGTGCCACTGATTGGCCATTGGTGGCATCC
TCGCTCATCAGCTAGCCAGAGCGAGTCTGTCAACTCCATGCGAGAGGAGATACTTCGAACGCTGTTTGCGCTTCAGCTCC
ATATAAGCGCTCTTGCCCTGCATTCCCCACATTGTGGGATTTTGGAGAATATTAAGGATGTCCTCGACTCGTTGTGGATG
GAGTATTCGAAAAGAGATGACCGGACGAGATTGCAAGCATCGGACATTTCGTTTTCATTCATCCCTACCAGCTACTTCAG
TGCGCGCATCTTCGGTCTCTCTACGCATGATGCGATGTCTGAGCGTCGATGGGCGGCTATAGAGGTCATGGCCCACCTCG
AGTCAATATACATGTCCAATGCAAAAAAACTCGACAGTCCCGATGAAGCAGACAGAGATGAGCACCCGCGCAAGAGGAGA
CGTGTCGGCGAACGGCCAGACAGAATAAGAGACAACCTGAGCTCTTCTGATTTAGGACTAAAGCTGACGGCACTTCAGAT
AATACCCTTCTTTCTGCAGGCAGCGAGCCCCATCCCGGTCGATGCTACATCCGATCTTCTCTCTCATCTCAGCCAATCCA
TTAGTGACAAGCAGGTTCTGGTTAGCTCCTGGGCAATGATTGCCTGTGCAAGGTTTGGACGGAACCCGTCTATCTGTTTG
ATTATAAACGGCTAACAGATAACAGCTGCGCAGCCCAGATAAGTGCAAAAGACAGCTCTCTCTCTGAGACATGGATGCAG
ATCTGGCAGATTGCCGCTCGGTCCGTTAGCCTACCTGGCACGAGCCGTGCTGCCTGTGCGCTGCTTCATACCATCCTGGA
AGCAGAGCTGATTCCGCACCATGTGATTGGAGACGATATAAACAGCCTCGTTACCGTGGCCGAAGTCAGTGGCCCGGCGG
TTCTTTGCGACTCGTCTCTCATATTGATGCTCCACTTGCTTCATCTTCGAAACACTATTTTACCAAGTGCCAGCGAAGTC
ACTTCAAATCAAATCATCCGCTGGGCATTTTCAAGATGGAAACCAGGTGCGAAAATGTGGCCCTGCATATCACTCTATTT
TCTGACTGGCTAACGTTGCGGCAGGTGACTCGAACTTTGCTTCTTCGTACTCGGCCCATGCACCATCGTTTGATTTAGTG
AATCTTTTCATGGCATGCTTAGGTGCTCAGAGCTTAGGATTTCCATGTCCTGTGGAGCCTTATGGAGGGTCTATAAGCCA
ATCTTGGAAAGATCAGGCCGAGGCGGACGAGATGATGCGGTATCTTCTGTTGCTGCCAGACATAGAGTCTTTGCAGGTAA
GACACATGGCATGTGTCCATTCCTCCATAAGCGACACGTCCTCCCGATTCCAGGACTCTGCGAGCTCCAACTCTGCCAAA
AAGACCGTTCTGGAGCTTCTCCAGCCGGTGACTGATGAGATCATGTCGATGACGGACACCTGGACACGACGGGGGAGCGA
TAATGCAGCTCAGATTTCGATTCCACGAATGCAGAGTCTGGCGGCGTTCTGCATAATATGCAGCATTCTCACGCCACAGC
TCGATCCTGTCAATTCGAGTCTTGCGAGGGATCTGGAGCCGACTTTGCTGAAGCTTATTGACGTCATTTTAAAAACACTT
CATGAAGTGGGCCAGAGCAAAGCACTCTTTGAGGTATGGCTTTTTGAAGTCGCTTTTTATCTGCCCAGTATAACGGTGTC
AGAAAGTGAGCGGTTTGGAAAGGAGCATCCAGTCTTGCTGAAACTTTTCGCCAAATTGTCCCAAGCTCTTCGCGTGGAGA
GCACCAAGCAGAGTTCTGTTCCCGATGGAGATTTGATGGAGCTGGACGACGAGTTTGACACAGCAGTCAGCCAAGGAGAC
GTCACTTCGAAAACAACGATCATACCGAGACAAACATTGTGTCTCGACATAATCCCGGCGTCCTTCTATCTCAATGTGAC
CCAAAGACTTGAGCTACTATGGCACTGTCACAAAGATGGGAACGACACGGGCGTGCTGCCAGAAGCCTTTGTAGACCAGT
TTCTGGAGCTGTCCAACGAGGACCTGCTGCTATGCCACAGCTTTGCAAAGGAGCTGTTTCGATCGGACTTGGTTGTGACT
CCAGAAGATTCGCTCAGGGTTGTCGAAGTCGTCGGAGACGTGATTGGGCTAGGAGAGTACTCATGCTGCGAGGCGGCACT
CAGTATGTGCATCGACATGATGCAGAGCTTCATTTGCACATGGCCGGATGAGAAGCTGGAGGTGTCGGCCAGAATTGGAG
ATCTCTATTCGTATCTGGTGCAGCAGTCACTGCCGAAAAACTCGCTGTCGGCCAACGCGCAGATCAATCTGTCCGGACTC
TTGTACCGGTTGCTGGAAATCAACTCGTCTTATGGAGGGGACCTTGGTTTGGCGTCGTGCCGGTCAACGCTGCTGTCGAT
TCTCCAGAACGGCAGCATGGCGGTCAAGTATTTTGTGGGCATGAACATACCGAAAGTCTTTGGCTTGTACGTGTTGAAAG
TACACGATGACCTTTTTGTGGACATTCTGGAAATTTTGCCGTCCGATGCGGGCTGGCCTGAAGGCATTGCCTTCCGGCTT
CTCGCGCTGGCAAAGCTGGCGTGCACGTGGCCAACGCTACTTCGACGGTGCATCTACCACATCTTTGAGACACCAGGCCG
GCTGAGGCAATGCGCCAAGTTTGCGAGCCGCTGTTTGGCACAAGTATCGAATGCACTGGCACTGGCATCGTCGAGAGATC
TGTTTCAGCTCTTTGCGCCGCAGCTACTCTACACCTGGCTGGAACACGACCCGATCGACGAGATCCCGTACGAGATATTC
TCATTCAGCAGTCTTGACGGGCTGATCGACCAGGCGCAGACGGAGGCAACAGCTCTGATGTTGATGCGCGGCCAGGACAT
GGCTGCATCGCATATTGCGCAGCGGCTCGGGCTAGAGCTACCGAGTCTAGTGGAACAGAACTTTGCGGAGGTCATGGCTT
ACAGCGTTGCCCACGACATAGCGATGGCGACAGATAGGGAGAAATCGAAGGCTGCAGGCGAGAGTCGGCTGCGCAAACTG
CTGGGAAAGGATCGGTTCCTCGATGCTGTGTACTACAATATGGCAGATATTGTTGGGATCCTGTTCAATCTCATTGACCA
GGAGGACCCGATCGAGAAGTATTTCAGCAAAGACGACTCCCTGCAATATGCGGCCGACATCATGGCGGAAATCAAAGGGT
TTGGACACTCTCCGGTGGTGCTGCCTCCCAACCAGCAGCCAATGTTCAGGGGAAAGTTTCTGGCGAGGGAGCTTGCGCAC
CTGTGCAGCCGGACAGAGTACGACCTCAGCACGCTGTGGACACCTGCCTTGGTGGTCTCTGTGGCGAGACGGCTCATGAA
TACGATTCGGCCGGCGTTGGGGTCTCTGCACGCGTGTTCTGTGATCCGAAAGGTGCGGGTGCTGATATGTCTGGCTGGGG
AACAGGCAACCAGCTCGTACCCGTTGGAGATGTTGCTGCACGCGATCCGACCGTATCTACAGGACGCTGAGTGTGCGGAC
GATACGCTCGGGATGACGCGGTACCTTTTAGTCCGAGGCACAGGACACCTCACGCAATTTCCGTCTTTTTACGCAGGGTA
CTCGCTGTCGATGCTGGCGTCTCTGCGGATGTTCCTGGAGTCGAGCCAGGCCAGCACGACACAGGAGAATCAGTTCAAGG
CGACGATGGGCAAGGCACAGCACTTTCACACGTGGTTCACGAAGCAGCTGCTCGAGTACGACTCGCACGCGTTTAAGGAC
GATGCACAGCGGACGGCATTCCGGTCGATCACACAGTCGGCAACCAAGATCCGAGCATCGGGAAACGCGGAGAAGGGGAC
GCCGGAGAGCACACTTCTACTGGAGATGCTGAAGGACGGCGCGCGGCAGAACAGGCTACTGAACGAGTCGGCACGGGATC
TGGTGCTGGGAATGCTCTGTGGTGACTTCCAGGTGCCGCCATGGGGACGTTCGGACATCATAGAGACGGACCAGGACGCG
CTGGAGCACGAGGCAGAGGTATGGAAGAGCTGTGGCGCACAGGCCCTGAGTGAGGGCTACCTGGTATGGGCTGGACGGGT
GGTGGGACGGTCGTTTGCAGCATCGGGGACGGTGCCGGAAGAGCTGGTGCGGGAGCTGCACATATCACAGGACCGGCAAG
CGGCATCGGCAAGCGGCAGCTCGGAGCAGGGTCTACTACATCTGCTGGAGACGCTGACGGTGAACCGCGAGTCGGTGACG
GCAGGACTAGCCGAGTCGGGGCTGCGGACGATCGTGTCACAGGCGACGAACGAGGGAGACAGCAGTCTACTGCTAGCGTG
CCAGGCAAGCTTGCCGGAGCCGCTGTTTGTGTCGTCGGCATGGGGCCTGTATCGAACACCGCCGTCGGACTTTGATCGGG
TGGCACAGAAGCGACAGGTGAAGCAGACGAAAGGAGAAAGGTCGACGGGTGCTGGAGTGGACGTGTTCGCGGCCAGCCAG
ATTGAGGAGGCAGACTGGACGCAGAATCTGGCGGTACACCTGACGAACAGCATCCCAGAAGATGTGGTGCTAGGGGTGCT
AGGGCCGATTGTCAGGCTAGAGAAGGGGTTCGCAGAGAAATGCCTGCCGTTCATCGTGCACCTGGTGCTGCTGTTCCAGG
TGGACAAGCAGCAGACATTGAAGCGACAGCTGTCGGAGGCGGCGACGCAGTGGCTCGGCTGCAGGTCGCGGTCAGGGCGA
GAGAACGTGAAGCTGCTGCTCAGCACGATGGTATATCTGCGGACACAGCCGCTGCCAGGCGAGACGTCGATTGCGGACCG
GCAGCAGTGGTTGGCGATCGACCAGACAGTGGCAGCAGCAGCGGCATCGCGCTGCGGGATGTTCAAGATCGCGCTGCTGT
TTGCAGAGATTGGGCTATCGGAGACGTCAGAGACGTCACGGACTCGCAGCTCGGGGACGAGCACGAGCATGACGACGACG
GAGCGGCGAGATCTGCTGCTGGGGATCTACGAGAACATCGACGACCCAGACGCATACTATGGGGTGCCGCAGAGCCCGAG
TCTGGCGAGCGTGCTGGCACGGCTGGAATATGAAAAGGACGGAGCGAAAGCACTGGCGTTTCGAGGAGCCCAGTACGACA
GCCACCTGCGACGGGGCGACATGGGGGCGCTGGCAGACAGCCGGGCGCTGGTGCAAGCACTGAGCAACAACGGGCAGTCG
GGACTGTCACAAGCACTGCAGCAGGCACAACAGGACGCGGGTGGCGGGACGACACAGACGTCACAAGACAGCACGTTCAC
GACAGCACGACGGCTGGGGGTGTGGAATCTGCCGGTGGCGGCAACGAGCAGCAACGGGTCGGTGACGATGTACCGGGCCT
TCCAGCAGCTGCACCAGACGACATCGGCAGTAACAGCACAGCAGGCAGTTTGGGCGGGCTTGGGCCGGACGATGCGACAG
GTGGTGAGTCGTAGCGCGACGGTGGCGGCCCTACGACGACAGCTGGGGGCACTGGCGGCACTGACAGAGCTGGACGACGT
GCTGAGGGTGCGGGGAGCAGACGAGCTGTCGGCAGTACTGGCCAAGTTCGAGGAGCACAGCGGATGGATGAAGAGCCGGC
AGTACGACGATGTCAGCCAGCTGCTGTCATATCGCGAGACGACGCTGAGCACGATCGGACAGGCAGACTACCTGCGACGA
CAGATGCAAGTGTCGGGGGCAGAAGCGCGTGTGGCCGAGGTCAAGGGTCTGCTGCTGTCGTCGCGAATGTACCGATTCCA
CCACGCGATGCAGGAGTCGCTCAACGTGACGACAGCGCTGACAGACCTGATTGAGCCGAGCGCAGCCATGGGGCTGCAGG
TGGAGGCAGCCGTCAAGATGGAGACGGCCAGCTCGCTGTGGGAGCAGGGCGAGCTGATGGCGTCGATCGGAATCCTGCAG
AGCGTGGAGGTGCAGCAGCAGACGGTAGAGGTGAGTCGGGCAGAGCTGCTGTCGCAGATCGGACAGGCCGTCTCAGCCGC
ACGACTAGAAGGCGCAGACGCGATCCAGAAACGGTACCTAGAACCAGCACTGGCCGAGCTGCAGGGCGGACGAACGGGCG
CCGAAGCCGGACGGGTGTTTCACCAGTTTGCGACGTTCTGCGACGAGCAGCTGCAGAGCGCAGACGGACGGGAAGATCTG
GCACGGCTGCAAAAGCTGCGACAGGGAAAGCGAAGCGAGGTCGAGCAGCTGGAAGCACTGGTGGCCGGGGCACGGGACAC
GGCGACGCGCCAACGATACAACAGCCACCTGGGAAAGGCACGACAGTGGCTGGCGCTAGACGAACAGGAGCTACAGCGAG
TGGAACGGACGCGGGAAGAGTTTGTGCGGCTCAGCGTGGAGAACTACCTGCTGGGGCTGCAGGCGTCGGACGAGCATAAC
AACGACGCACTGCGCTTCACGGCCCTATGGCTGGAGCGAGCCGGCGAGACGGGAACGAATGAGGCGGTGCGCCGACAGCT
GGAAGCAGTGCCATCACGAAAGTTTGCACCCTTGATGAACCAGCTGACCTCACGGCTGCAAGAAGGAGGGGGAGCCTTCC
AGAAGCTGCTGATCGGACTGGTCTTCCGCATCTGCAGGGAGCACCCGTACCATGGCATGTACCAGATCTGGTCGGGCGTG
CGGACACGGCCAAACGCCAAGGATGCCGTGGCAGTGCGACGACAGAAAGCGACAGAGCGAGTGGCTCGCGAGCTGGCACA
TACAACCGCCGTGGCAGCCATCTGGCAGGCCATCGACAAGACGAGCAAGTGCTACCACACGCTGGCGGTCGAGCGTGACG
GCCGCTACAAGGCGGGACAGAGGGTGGCACTGCGTGATTCGGCCGCTGGCAGCGCGCTGCTGCAAAGTCTTGCTCGCTAT
GCCATCCCGCCGCCGACATTGACGATTCCGCTGCGGGAAGATCGGGACTATGGCCCAGGTCACGTGCCCACGATTGTGCG
ACTCGAGCCGACCATGTCGGTGGCACTAGGCGTGAGCGCGCCCAAGATCCTGACGGCTGTGGCCACCGACGGCCAGCGGT
ACCGCCAGCTGGTCAAGGGCGGTAATGATGATTTGCGCCAGGACGCCATCATGGAACAGGTCTTTGCGGCCGTGTCGGGG
CTGCTGCAACGCCACCGTGCAAGCCGACAGCGGCGGCTGGGCATCCGCACATACAAGGTGCTGCCGCTGACAGCGGCCTC
AGGCCTGATCGAGTTTGTGCCACACACTGTGCCGCTGCACGAATACCTGATGCCGGCTCACGAGCGTCTGCACCCACGCG
ACCTGCGGGGGGCCCAGTGCCGCAAGGAGATCTCGGCCGTGCAGACGCAACCAACAAACGCTCGCGTGGCTGCGTATCGT
CGCGTTGCCAGCCGCTTCCGTCCGGTCATGCGCTACTTCTTCCTCGAGACCTTTCCCGACCCTGACGACTGGTTTGCGCG
CCGGCTGGCCTACACGCGAGCGACAGCAGCTGTGTCCATGCTTGGTCACGTGCTCGGCCTAGGTGACCGACACGGCCACA
ACATCTTGCTAGACGCCCGCACCGGCGAGGTCGTGCACATTGATCTGGGCGTTGCCTTTGAGATGGGCCGCGTGCTACCG
GTGCCCGAGCTGGTGCCGTTCCGGCTGACGCGCGACATCGTCGACGGTATGGGCATCAGCGGGCCTGAGGGCGTCTTCCG
CCGCTGCTGCGAGTTCACTCTCGACGCCATGCGCGCCGAGACCTACTCCATCATGACGGTGCTGGACGTCCTCCGCTACG
ACCCGCTGTACTCGTGGTCCATCTCGCCCGTGCGCCTGGCGAAGCTGCAAGAGGCCCGGGCACGGGCCGACGACGGCGAC
GACGGAGAGCCCGACGTGGCTGCGACTGCAACTGCGACTGCGGCTGCTGCTACCAACACGGCTACTGCTGCCGCTACCAC
CACGTCCACAACCAACCACAATGAACCGTCCGAGGCCGAACGCGCGCTCGAGGTCGTGCGCAAGAAGCTGTCCAAGACGC
TCAGCGTGGCCGCCACGGTCAACGATCTGATCAACCAGGCAACTGACGAGAGAAACCTGGCGGTGCTCTACTCTGGTGAG
TAGTCCAGAGTTGCCGCTTGCCGTGTTCAAACGTGAACGTTACTGACACATCTAGGATGGGCCGCATATGCTTAGTAATC
GCTTAGTAGTGAATATATTGGATAGTGAACTATTGGATAAACGCATCTACCGTAGCGGGGTGCTCCGGCTTTTAGCCTGC
AAGGCCGACGCGTTGCCAAGCTTCCCTTCCCACTCCACCAGCCGTTCGTCTGTGCTCTCCGTCCGTCATCTCGACCTCTC
TGGCGACTGCATTCCGACCGGCAAGAGCGGCAGCCGGCATACACCTCGACGCACGACGACGCACAGCCACCGCAGGTCGG
TCTCTGCTCTCTCCACTATTCTCTCTTATCTCGTTTCCGTCATCCTCATTCACCTCTTTTCATCCTTCCCCCCCTCCATG
CATCCGTCTTCCGGACCCGCAGACGGCCGTCTCCCTGCATCCTCCAACTCGCTTGCACCGAACAGCAGCAGCAGCAGCAG
CAGCTCCAGCGCCCGCCGCCGACAACGGGTCGACTCCAGCTCACAGCCCCAGCCAGCAGCCCTGGCTCCACCCGAGGCCA
AACGTCAACGGTCGTCTGGCCGAGACATCTTTCCGACCATGAACGCCAAGACGCAAGGCAAGCGGCCCGATGTGATCGAC
CTGACGGAGACGCCGTCGTCACCGGCATCCGGGCCTCTCGCGGGCTCTTCCACCGCTGCCACAATGGTCCACACTTCCAC
CAACACACACGCCAAGATGATGCCGCCAACAGCCGTCTCGGGTTTCCAGCCGCACGCGGGCGCCAAGAAGCTCGTGATCA
AGAACCTGCGGGTGGCGTCGACCTCACGGGCCCAGGAGATGGAGCAGTACTACCAGCGGACGTGGACGGAGATCGAGGAA
GCCGTGAAGGCCATTTTTGCCGGCCGGCCGCCACGGCAGCCGCTGGAGCGGCTCTACCGCGGCGTCGAGGACCTCTGTCT
GCACGACCAGGCACAGCGGCTGTACATGACGCTCAAGGCACGCTGCGAAGAGCACCTCAGCAAGACAGTGCTGCCGCAGC
TGCGGGCCGACACGCGCGGCGCCTCCAACGTGGACGTACTCCGGGCTGTCTACCGGCAGTGGCAGGTGTGGTGCGACAAG
TCAACGCTGATCCGGTCGACGTTCAGCTATCTGGACCGGGCGTACGTGCTGAACGAGCGGTCGCTGCAGCCGATCAACGA
CATGCTGCTGTACCGATTCCGCCGCATGGCCTTTGACGGCAAGGCCACGGAGCCGCAGGTGATGCCGCCGGGACGACAGG
TGCTCGCCGGCATGTGCGATCTCGTGACGGAGGACCGTCTGGGCCACGCCCGGTTCGACGGCTCACTGCTGCGCGAGGCT
GTCACCATGATGCACGTGCTCAACGTGTATGGACGCTACTTTGAGCCGGCTTTTCTGGGCGCTGCCGAGACGTATCTGCG
CGAGTTTGCCGCCGAGCGTGACACTGCCGCTGCCGGTGACTTGACGCCTTACATCCTGGCGGTCGATGCGCTGCTGCGCC
GCGAGGACCTGCGCTGCAATGAATACAGCTTTGACAGCTCGACCAAGAAGGCACTGCTGGACATGGCGCAGCGGCTGCTG
ATTGTGGAGCGGGTGCCGATGCTGGTGAACGAGGCCAGCGTGGCGCGGCTGCTGGACGGTGGTGCGGGCGGTGGGACGGG
CGACGCGACGAGCGTCAGTTCAGCCAAGGCGCTGTATGAGCTGCTGCGGCTGCCACGGCTGCAGAAGCAGCTGCGCCGAC
CATGGGAGTCGTACATTGAGGCGGCCGGCACGGCCATCGTGACAGACACGGCGCGGGGCGACGACATGGTCGTGCGGCTA
CTGGAGCTGCGACGCGGACTGGACGTGCTGGTGCGCGATGCTTTTGGGCGCGACGAGGACATGGCGCACGGTCTGCGCAC
AGCCTTTGGTCGCTTTGTTAATGGCCGGCCGGTGGCAGATGCCTGGCCGTCGGGTGCGTCCAAGGTCGGCGAGCTCGTGG
CCAAGCACGTGGATTTGCTGTTGCGCGGCGGCCTCAAGGCGCTGCCGCCGGCGTTGCTGTCGACCGGACGCGACCGGGCG
GCAGCTGAGCAGCGTGGCCAGTCCAGCACGGGCGATGAGGACGCCGAGCTGGACCGGCAGCTCGATCTCGCACTGGAGCT
CTTCCGCTTCATCCAGGGCAAGGACGTGTTCGAGGCGTTCTACAAGAAGGACCTGGCACGGCGGCTGCTGATGGGCCGCA
GCGCCAGCCAGGACGCCGAGCGTAGCATGCTCGGCAAGCTCAAGACCGAATGCGGCTCCAGCCTGACACACAATCTCGAG
CAGATGTTCCGAGATCAAGAGCTGTCACGTGACGAGATGGCCGCATACCAGCAGTGGCTCGACAACCAGCGAAACGACAA
GGACAAGCGGCGCGACGACGAGGATCGCCAGGCCGGTCGGCGTGAGATCCGGACGAGCGGTGGCGTCGACCTGCACGTCA
GCGTGCTCTCGTCGGCTGCGTGGCCGACGTACGGGGCGGTGCCGCTGCGGCTGCCGGCCGACGTGCTCGAGCAGGTCCAG
CTCTTCGACGGCTACTACAAGGCCAAGCACACGGGCCGCCAGCTGACCTGGATGCACGCGCTGGGGCACTGCGTCGTGCG
GGCGCGATTCGACCGCGGGCCCAAGGAGCTGCTGGTGAGCGCCTTCCAGGCCGTTGTGCTGCTGCTGTTCAATGGAGGGG
ACGAGGGAGACGATCCAGACACAACACCTCCCCCCGAAGCCCTCTCGTACGACCAGATCGCGGCGGGCAGCGGGCTCGAG
GGCGGCAACCTGGACCGGACGCTGCAGTCGCTGGCGTGTGGCAAGGTGCGCGTGCTGACAAAGCACCCACGGGGACGCGA
CGTGCGGCGGACAGACACGTTCTCGGTCAACCGCGGGTTCACCGACGGCAAATACCGGATCAAGATCAACCAGATCCAGC
TGCGGGAGACGCGGGCGGAGAACGCGGCAACGTACGAGCGCGTGTCGGCGGACCGACAATTTGAGACGCAGGCGGCCATT
GTGCGGATCATGAAGAGCCGCAAGAGCCTGCCACACGCACAACTGGTGGCCGAGGTGATTGGGCAGACGAAGAGTCGCGG
GGCGCTAGACCCGGCGGAGATCAAGCAGAACATTGAAAAGTGAGTAAGAGGTGAGGTGAAGAGGAGAGGGGGCGTGACGA
GGCGAAGTGAAGACAGAAGAGAGGAGAGAAGAGAAGAAAAGAGAAGAAAAAGACGGGAAAAAAGCTAACATCCCCAGACT
CATCGAAAAAGACTATCTCGACCGCGAGGGCGGCAACTACGTATATCTCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62