GenePrediction:GLEAN_1543 Details

Name: GLEAN_1543
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:548161..549206 (+ strand)
Length: 1046
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:548161..548351 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_82:548558..549206 (+ strand)
Length: 649
>GLEAN_1543 class=GenePrediction position=GCSC_82:548161..549206 (+ strand)
ATGCCCAAGTCCAAGCGCGAAAAGCTCCTCCACCTGACGCAGGTCGCCAAGAAGACCCGCGAGCACAAGGACCGGCTCTT
CTCCAGCATCCGCGACGCCGTGCCCGAATACGAGCACTGCTTTGTCGTGCACGTCGAGAACATGCGGAACCAGCATCTGC
ACGAGCTGCGCCAAGAGCTTTCCGACAGTCGGTACGTTTTTTTGGTTCCTCGCTTCGCTCGTGTCTTTTTGTTCCTCGCT
TCGCTCGTGTCTTTTTGTTCCTCGCTTCGCTCGTGTCTTTTTGTTCCTCGCTTCGCTCGTGTCTTTTTGTTCCTCGCTTC
GCTCGTGTCTTTTTGTTCCTCGCTTCGCTCGTGTCTTCTTCCTCGCTCATGTCTCTCATCCACACTAATTCCATCAGCCT
CTTCCTCGGCAAGACCAAGCTCATGGCTCGCGCCCTCGGCACGTCGCCCGGCGAGGCTCTCCTGCCCGGCATCGACCGTC
TGGCCGAGCGGTACATGCACGGCACCGTTGGCCTGCTGCTGACCAGCCGCCGCCCCGACGATGTGCGCGCCTACCTCGAC
GCCATCAGCCCCGTCGACTTTGCCCGCGCCGGCACCGTGGCCACCCGCGACGTCATCATCCCCCACGGCCAGCTCTACAG
CACCGGTGGCCTCGTGCCTGCGGCTGACGACGTCCCCATCGCCACCGCTCTCGAGCCCGAGCTGCGTCGTCTCGGCGTGC
CCACCAGCATCAAGGCTGGCAAGGTCGTCCTCGAGGCCCCCGACAACGCCGACACCGACACCGACAGCGAGACCGCCGCC
GTCGGCGGCTACCCCATCTGCCGCGCCGGCCAGGTCCTCGACAGCCGCCAGTCCCGCTTGCTGCGCCTCTTCGGCATCTG
CCTCAGCGAGTTCCGCGTCGGCGCCCTCGCCTACTGGTCCGCTGCCTCCGGTGAGGTCACCGAGCTCGCTCCCCCGCTGC
CGTCCACGACGTCCGCTGGATCCCGCGCCCTTAAGAAGACGGCCGCCGATGTCGACGACATCGTCGTCGATGACGATGAC
AATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62