GenePrediction:GLEAN_1544 Details

Name: GLEAN_1544
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:552607..553463 (+ strand)
Length: 857
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:552607..552789 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_82:552851..552922 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_82:552975..553463 (+ strand)
Length: 489
>GLEAN_1544 class=GenePrediction position=GCSC_82:552607..553463 (+ strand)
ATGGCCACCCAAGTCGATCTCACCACAATTCCGATCTCGCCTGATGGCGGCAACGACTCCGCGTCAGCCGCAGCAGAGGC
CAAGGAAGACGTCACCGTTTTCCACGACAAGGAAAATTTCAACGTGAAGCACCGGCTTATGCATACCTGGACCCTCTGGT
TCACCAAGCCAGCCAGCGGCAAGGTAACCAGGACATAGACAGTCAATGATGCAGGGAGTATGCGACAGCTGACATTATGG
TTAGGGCGACAATTGGAACGACCTGCTGAAGGAGGTCATAACTTTTAACTCCGTTGAAGAGTTCTGGGGCATTTATGTAG
GCATTTCCCTTCTCTGTGCGATACCTGGCGTTCTAGCTAACCGACTAGAACAATATTGCTCCCGTCTCGGAGCTCGCTCT
CAAGTCCGACTACCACCTGTTCAAGGCAGGCGTCCGGCCTGAGTGGGAAGATGCCCAGAATAAGCACGGTGGCAAATGGT
CCTACTCATTCCGCGACAAGCGTAATGTCGACATCGACGAGATGTGGTTGCACACCATGCTGGGCGCCATTGGTGAGACG
CTCGAGGAGGAGGAAGACGACGAGGTGATGGGCGTGGTCGTCAACGTCCGGAAGGCCTTCTTCCGTATCGGCGTCTGGAC
CCGTACCATCGGCAAGTCGATTCCTGGCCGTGGTGATGGCGATACGTCTGGCGGCAAGGGCCGGAGTCCCGAGAAGGCTC
GCGAGATCCTTCTGGCTATCGGCCGGCGGTTCAAGGAGGTCCTCAAGCTGCCAGACAACGAACAACTCGAGTTCTCAGGC
CATCTAGACGCACAGCACAGTGGCAGCACACGAGCCAAAGCAAAGATGACGGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62