GenePrediction:GLEAN_1545 Details

Name: GLEAN_1545
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:556734..557143 (+ strand)
Length: 410
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:556734..556778 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_82:556832..557143 (+ strand)
Length: 312
>GLEAN_1545 class=GenePrediction position=GCSC_82:556734..557143 (+ strand)
ATGGCCACAAGCACTACTCCGGTAGAAGACCTGATCCGCGAGAGGGTGAGCTTTTCCTCCCTATTCTGCCGTCCTATTCC
TGACCTCGGCCTCCGTAGCTCGCTCCCCTCAAGCCTAGCCGTCTGGATATCTTCAACGACTCACACCTCCACTCCCACCA
TGCTGCCATGGCTGGCCGCGTGCAGTCTGGCGAGACCCACTTCCGCATCGTCATCACCGCCGAAGCTTTCCGTGCCCAGC
GCCAGCCGGCCCGCCACCGCATGATCTACGGCCTGCTGCAGGACGAGATGCAGCGCGACGGCGGGATCCATGCGCTGCAG
CTGCGCACAATGACACCGGAGGAGGACGTCAAGCGTGAGGAGCAGAAAAAGAGCGCCGGAGACGCTGTCGGCTGTGGGCA
AGAACACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62