GenePrediction:GLEAN_1546 Details

Name: GLEAN_1546
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:560886..570628 (+ strand)
Length: 9743
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:560886..568687 (+ strand)
Length: 7802
Type: CDS
Source: GLEAN
Position: GCSC_82:568766..568855 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_82:569020..570628 (+ strand)
Length: 1609
>GLEAN_1546 class=GenePrediction position=GCSC_82:560886..570628 (+ strand)
ATGTCGTCCTCGAGAATGCCTCCGCAGTCGCCCGCCTCCCCATCTCCTCACTTTGAAAGATTATCTCGTCGGGGCTCTAT
CGCTAGCCAGTCCACCACTTCGCAGGCCGACAAGGAACAGCTGGCCCAAGCTCTCGACAAGATTCACAACTCTGCAAGCC
AATCCGACATCTTGACAACCTTCAACGACTTCGGGCCACCTCCTACGGCTGCAGCTCCCGTCGTTGAACCAAAGGGGACG
GCTAGCGATCTAGTACAGCAAGGGCTGAGCGGTTTTTACTCGAGGCTCAAGGAAGCTGTTGGTGTTGGTGGGAAAGCTAC
CGCGACCGAATTAGAGGGGGGAACCAGCCATGATGGGGTGCCTTCAAAGAACAGTACACGCCCAACGCACACACGTTCCA
AGTCCTCTGTCTCGAGCCTTCCGAGAGGCGAGAGCGGATCTACGAACACAACAGTCAACTCCATACTGTCTGAGATACCT
ACAATCGCCGCAAACACCTCGGGCGGCATAACGTCAGATAAGGCATTACCTTCCTCGAAAGCATCATCCATCACTACTTC
GACATCCGCATCAACTGCAAAATCTGCTACAGCGACCCAAAGTCTCTCAAAGGTGGGCAGGGCACCAGCGCCTGCTGTGG
TCGACACAGCCATAGCATCTGGCGCTGTAGGATTGTATAGCGAGCCTTTGCGGGACCCAGGAGGGCCACGTACTTCAGAA
GAGCTTGCATCTCCTACAAATGGCAGGAGACGACCTGCCAGATTGAACGAGTCTCATGTGCCAAGCTATTCCGCTGGATC
TAACACCTATGATGGTCCTACCGAGCGAAAGAGCAACGATATCCCAGGTGTGGCTTCTGCTTCTCTTCGATCTGCTAAGG
ATGACGGCCCAAGTCAGTGCAGCTATCCCGATGCGATACACAGCCCAGTAAAAAGCACAGGGCCATATCGTACGTCGAAT
CACAATGGCGCCAATCCGTTGTCTGTGATCGGAGTACACGGTGCAAGTGCCAAATTGCATGATGACTTGAAATCGCCCTC
CGCTATCAACCAGCTAAATGTAGGAGGGACGCCTGGCGGTTTTCACCCTCTCTCTTCGGCATCAGAACGGACCTTTGTGG
AAGCTAGCCCAATCACAACATCTGCCCATATCATGGTAAACCACGATTCGTTCGCGCACGATACGAGACCTCAGAAGCTA
CCGTCAGGACAAGTACGGATCAACGGAACAACGGCAACGGATGGCACAAGTGAAAGCGTCAGTGCACGTCTGGAACTTAT
GAGAAAGCAGATCCTAGGCAAAGAGTTCTGGATGGCCGACGAGACCTGCAAAGAGTGCTTTCAATGTGGCGACCCATTCT
ACGCTTTTCGCCGAAAGCACCATTGCCGGACCTGTGGTTGGATATTTGACTCGAAGTGTACATCAACCATATCCGGAGAG
AAGTTTGGCGTTCCAGGCAGTTTGAAGGTCTGCATGAAATGCCTGGATGTCATCAACAGCAGATACGAGGGTGGCTCGGA
CGATTCTGGTGATGATGATCCTCGTTTGACGTCTCTTCTTCAGTCAAACACACAAAAATCCACGGCTGCCACAGCAAAGC
TGAAGACGGACGACGAACGCAGCATGTCCGAGAGGACCGATGAGATAGACGACGGACGATCGACGACAACCCCAATGATG
GCCATTCCTGCAGCCCGGCGGCTGGGAGATCCTTCCAATCGAAATTCGGCGATCCTAGAAATCGGTGCGTCGCAGCTCAG
CCGACCGAGCTCGTCTCGCTCTCTCAAGTCAATGGCCTCTGTGCGACCGACTTCATCAGGTCACGTGCGCCATCACTCGA
AGCACAACCTTCTCTGGAATAGCAAATCAACCGCAGAAGACAGAGTACCGTTTCGCAAAGATTTGTCCGATGAGATGAAC
CGCAGGTCGAAACTACCTGCCTTTCACGATGACAACATTATCGACCCAGAGCTCGCACCGTACATGTCTGACGAGTCGAG
CGGGGACGAACAGATGGGACTTTTCAGCACGTTGGCGAGCAAAGACATGATCTCTTCAAGCATCGATCCCGAAAGGTCCA
ATTTTGGCCCATTCCTGAGCGTTGGCCGGAAGCACCGTTCTCGCCAAGGCGAAAAGAGTATCAGTGGCTTAAGTTTCACG
AGCCGGGGAGTGGATGATGGCGTAGGCTCGCCAAGTGTTGCTAGCCACTCACGGGCAACGGGAAGGCGCAGGAATATGAG
CTCCGCCAGCATTGCTGCTGGCCAGCATCATCTTCGGTCACCACGCTCCAAACTGGGTGGATACAAGGGCCCTTCGATAT
CGAACGAGACGTTGAGTATGCTCGATGTTTTTGGTAGCATTGATGCCAAGGCTGCCCGGCCATCAACAGCAAAGTCCGAA
CCGACAAAGTTGAATGAGCCGAGCATCAAGCATACGAGAAAGCTGTTTAGACAACTTTTGGACGACGCTGCAATTCCGAA
TCCGTTAGCATGGGAGAAGGCTCTTATTCCTATATTGCGACGGTGTGCTGCTGAGGTAGACCCAAACACACGTGAAGGAG
ATCGCATGGACATTCGACATTATGTCAAACTGAAAAAGATCCCTGGAGGCAAGCCGAGCGACAGTAGCTACGTGTCGGGC
GTGATCTTCACGAAAAACCTTGCCCTCAAGAGCATGCCACGGCGAATTGCAAACCCTCGAATCTTGATTGTTTCTTTTCC
GGTCGAATACCAGAGACAGCAAGAGCACCAGTTTATGAGCCTTGAGCCGGTCATGTCACAGGAGAAAGAGTTTCTGAAAA
TGGTGGTTGCCCGTATCCGAAGCCATGAGCCAGAGGTTGTTCTTGCTCAACGAAATGTGGCTGGCTTGGCTCTGCAATCG
TTAGCAGAGGCCGGCATTGCCGTCGCATACAACGTCAAGCCATCTGTCATCGGGGCCGTCTCTCGATTTACCGGAACGCC
GATCATTTCTTCGATGGACATGCTATCTTTGCCTATCACAGTTGGGCGATGTGCTGCTTTCGAGGTTAAGACCTTCGTGA
ACAACGACATTCCTGGCCGAAAAAAGACGTACATTTTTGTGTCAGGCTGCAAGAAGTTCCTTGGCTGTACGATAGCTCTA
CGCGGTACATCGACTGAGCTTCTATCACGCATGAAAAAGATCACTGAGTTCATGGTATACGTTGTCTACAACCTGAAACT
AGAGTCCTGCCTCTTGAACGACAAGTCTGTCAAGACATCCTACGACATCGAAAGTACGAGCCTGCCGTCTGCTACGAAGC
AGCCCCCGACCGTTGAGAGCCTGTTGTCCGTTGACGGGCCTGAAAACCCAAGCCAAGAGACTCCGATTACAACCACGACC
GACGTTGATGCTGATCCCCTTGCAATGGCACGAAGTGGCCCCATTTCGATGGGGCATGCTGAAACGTGTCTGCTGGCGGA
TGGAGAACAGTCTCGTCAACTTTCAGAGAGTACAATTTCTGCCGAGAGTCTGCAAGGAACGGGAGACCGACAGCTGCCTG
AAGATGTGCCGGCACCAACCTTTTACAGCGACATGGTAGAGAAGTACAAGACAAAAATTCTTTCGGCATCGCCGTTTGTC
AAGTTCACGCAGCCATATCTTCTCGTGAAGGCCCGTGAACAAGAAACACGGCTTCTCTATCTCAAGCGACTGCGTGACCA
AGACATCCACGAAGAGAAGGGCGGATCAGAAGACAATACACCACAGCAGCAATTCCAACTGATCAATCCGAAAATGGTGC
ACGAAATTGGCCAGAAGGCGCCGCGATTGGTGATGGAGGTGCTCCACGCCGTCCACGATGCAGAGTACGACAAAGCGTTG
TATGCATACCAGACGCAAACGCGGCAGTGGGAGAACTACCTCCAAGTAAATCTAGACCTCTTCGATCCGCATTCACACCA
AAATATTGTCGTTCTCTACTCAGTGACCTGCACGGAAACCAAGATCCCGTGTACCGAACCTGGGCTGGTCGGTTTCTCCT
ACTACAATGAGGTTGATGATCCATTGAGTGCAATGAGCCCGGATGCCACTCTGGGCATGTATATACAGGATCTGTGTGAT
GGCGCCGAGGCACTGTGCAATGCCAACGGATGCGACCGACCTTTGTGGCAGCACCATCACACTTACGTGCACGGCGAGGC
CCGCGTCACCGTCTTTGTCGAGCCAGAAGCGAGACTTCCATCTAGTCCAGAGCCACCAAGCGAAAAGGAGGAGTTGGGGG
AGGACGAGGAAGATCCCATCTACGTGTGGAGTTATTGCAAAATCTGCAGACGGGACCTCAGAGTCAAGCGGCTTTCTGAA
AGTGGGTGGAAATACTCGTTTGGCAAGTATCTAGAACTCTTATTCTGGAACCAGTTTCTTCGATTGGACGAGGATACGAA
GTGCTTGCACGACTGCCACAAAGAGCATATTCACTACTTCAACTACCGAGGCTCTTCTGTGCGGATTCACTACGACCCCA
TTGACCTACTCGAGGTTGTTGTTCCTAGGGCACGGATCACCTGGAAGGTAGACCATGATCTAAAGCTGAAAAACACCATC
TTCCTGAAGATGCAAGAGCGCTGGGTTCGGTTTATCACGTCTTTGAATAACAGAATCAAAAGCATCCGCATCGACAGTGT
CCTGCCAGAAAAGGTAGAGAGCTGCAAGGCTGAGGTGGAGCGGCTTGCCAAGAAAGCCCAGGAGGATCATCCTCGATTGA
TCCGGGAATTGCAGCAAGCCTACATGCAGTCTAAACACTACGAAATCATCCCGTTGAATGCTGCCATGCGCTCGATGGCA
CTGAAGATCACTGAATGGGATGCAACGTTTGCAAAATTTGAGGCGGACTTCTTATCCGACAAAGACGTGCGGCAGTTGAC
CGTGATGCAACTCAGGAAGATGTTTACCGACAGCGAGTCAAAGGAGTCTCTTCCGGCTATAGACGGAACTTCTGTTGCTT
CCCTTGTATCCGAGTCTGAGAATAAAAGCTCTGTGGTGCCGACAACGCAGAGCTCGGTGGGGGGTACCGACTCCAAGCCA
GAAGAGTATTCCGCCCTGTCGACTGTCGAGGAACCGGCCATCCTCGCAGGGGCAGCGGTAACGACCAAGTCGCCGCTGGA
AGCAGAGGGAGAGCGAGCACCGGAGCAGCTGGTTGAGGCCGAGCTCGAGCTAGCCTCATCCGAACGGCAGGCAGATGAAG
CTCCAGGACAAGTGGAAGCACCCGAGGCGACAGCACAGACATCACCGACGCTGACTAAAACTTCGATTGAGATGGAGGCT
AGCACTTGTGACAGCGAGGTTGCAGCAGTTGATGCGGCTGACGCAGCTGACGAAGTTGAAACGAGCGCCGGGGCTGCCGT
CGTCGATGGTTCTCGAAAATCAATGTCTACAAGCAGTAGCCAAGAACTGCCAGGCAAAAGCACCGGCAGAACCTCGTCTC
CGGCTTCATCTTCAGTCATGACAGGATCGTCGCGCCCGAACAAATCTGGTCGTCCTGGTCCTGGTCAAATGTCACCGCAG
ACTCTGACGGAAAAGGTCGAACAACTCCGCAGGGAGTTCAAGTCACAGTCAGCCGAGGGCAGTCAGACAACACAGATGTC
CGGCAACAACAGTTCGCAGGCGCGGCATGCTGCCGACTATCGTGGAGCTTCTCGCAAGACAGGTTCGAAGGTGTCGCCTC
CCATGATCCGGACAGCTTCGCAGCCTGTCGGTGCTGTCCCCCGGATCAACTCTGGGCTGAGCAGGCAGGCGTCGGTGAAA
GATGCGAAGGCGTTGACGTCTGAGGGTGGACAAAGCGGCAACGGGGGGGAGGCGCAGAAACATGCAATGGACGTCTTGGG
CAAGGTGGACAAGAAGTTTACAGATCGTATCGGATTGAGCGCGCTGAAGTCGCACAGAAAGCCCGGGCAATCGGCAATTC
CCCGATTTGTGCACAAGAAGAAGGAGACCAAGGTGACCAATCTTGCGAAGCAACTGACTCGCGAGTTTGAAAAGGAGAGA
AACCGGGAGCGCATGCGGGCGGCAAAAATGCAACACCAGCCACAGTCCTACTTTCCCCGGTCATCAGTCCGGGCAATCGT
GGAGGTCTACGAGGACATCAACCAGGCGGTGCAGGAGCCGGAGCCGACGGATGGCGAGCAGCTATTTGCTTCGCAGCACA
GCGAGGGTCGGCCAGAAGACAAGCACCCGGAGACGGGAGAGATGGGAGAGGCTGGATTGGGACCCGCGGCGACAGCTGCT
CCTCGGACAGACGAAGTGGACGTGGCGGACCAGAGCGGCCAGCCGTCTTCGGAGCCACGGTCACAACAGCTGTCGGAAAG
CACGGCTGAAACGGCTGCGACGGAGGACCAGGACCACGAGCACAAGCACACCGAAAGCGCGGCAGGGTCGGACGGCGAAG
GCGGCAGCGATGCGGACCAGTCGTTGGAGGACATCCTGCCGGATGTAGAGACGATAGCCGAACATCTCGAGCCAAGCGGC
ACGGTTCCGGCGGAGCTTCAGAAAGACAAGAAGTCGACCCTGATGAAGATGCTGGGCAACTTCTGGGCCGAGCGATCAGC
AACCGGATGGCCGCCGCTGGACTACCCTCTCAATGCGTCAGACCACATATTCTTCGACTCGGACGTGATTGTACGGGAAG
ACGAGCCGAGCTCGCTGATCGCGTTTGCGCTGAGCTCTGAGGATTACATAAGCAAGCTCAGGGTCATCCAGCAGCAAGGA
AGGAAGGCAACGCGGCGGCAGATGAAGGAAGCGAAGGCCGCGAGCGGCGACAGTGCAGACGGCTCGGACGAAGGAGATGG
CGCTGTGCTGGAGATGAAGCAGAGCAAAGGCAGCGCGAACGTGGCGGGAGCGCAAGTTTCGGAAGGAGGAAAGGCCGAGC
AGACGAAGAAGGAGGACGATGAGGACGACGAGGCGACGAGCAGCGAATCAGAAGCGTGGTACGAGATGGATGAGAAGGAG
CTGGAGCTCAGCCTTCTGCGGTCGATGGGGACACACCTGAAGTACCAATTCACGGAAGGGTCTGCACGGATGATGTGCAA
GATCTTCTACGCGGAACAGTTTGACGCACTGCGACGGAAGTGCGGAGTGGCGGATCGGATTGTCGAGTCGCTGTCGCGGT
GTCTCAAATGGGACTCGAAGGGAGGCAAGACCAAATCGGTGTTTCTCAAGACGCTGGACGACCGGCTGGTGATGAAGGCG
CTGTCGCCGGTGGAGACGGCGGCATTTTTGCGGTTTGCGCCGTCGTACTTTAGCCTCATGGCGGAGTTTCTGTTTCACGA
TTTGCCGTCGGTGATTGCGAAGATGCTGGGGTTCTTCCAGGTGATTGTGAAGAACTCATCGACGGGGACGGAGATCAAGC
TGGACCTGCTGATCATGGAGAACTTGTTCTACGATCGACAGGAGACGCGCAAGTTTGATCTCAAGGGTTCGATGCGCAAC
CGCAAGATCCAATCGACGGGCGAACAGAACGAGGTGCTGCTGGACGAGAACATGGTGGAGTACATCTACGAGTCGCCGCT
ATTTGCGCGAGAGCACGCGAAGAAGCAGCTGCGGGCGTCAGTGTGGAACGACACGCTATTCCTGGCGCGGCAGAACGTCA
TGGACTACTCTCTGATGGTGGCGGTAGATGAGTCGCGCAAGGAGCTGGTGGTGGGCATCATCGACTGCATCAGGACGTAC
ACGTGGGACAAGAAGCTGGAGAGCTGGATCAAGGACCGCGGCTTTGCGGGCGGCGGGCGCAACCGGCCGACAGTAACGAG
CCCGAAGGAGTACAAGTCGCGTTTCCGCGAGGCCATGGAGAGGTATGTTGACTGTTGATTTGGGGGGGGGGGGGGGGGGT
TTGGGCTTTCTTTGGGCTTTCGGCTAACGAACCAACACAGATACATCCTGCAAGCTCCCAACTGCTGGCACCTGTTTGGC
AGCATGGGCTACACGCATCCAGCGCTGGTGCCACGGGCTCACTTTGAAGGGTATGGGGACGACTGATGGGGAGGGTAGAG
AAGACGACGATGAGGTAGAGCATGACGTAATGGCTTTGTAAGATGTTAGATAAGGCGGCAACGGATAGAAGGCGGTGCGC
GCTAATAGAAAGTGGTGCTTTGATCCCCGCTTCAGCACGTTCTGCCGGCTGTAGCCGCCAAAACACGCCGCCAAAGCACA
AGCCGTGTGGAAACCAGCAAAAGAGACAAGCAGGCCAGGCCCTCCGCGTCCACATGTCGATCGACCTCAACTGGGACACG
CTGACGACGGGGCCGGACGGCGTCGAGCTGGCGGAGCGTATCCGTGATTTCATCCACAGCAAGTTCCAGGCGGTGCCGCT
GCCACGGTTCATCAAGTCGGTGACGGTGCACGAGTTTGAGTTTGGGAGCATTGCGCCGGAGCTGGAGCTCAAGGATATAA
CGGACCCACTGCCAGACTTTTACGAGGAGAGCGAGGAGGATGAGGATGAGGACGAGTATGAGGATGACAGCAGCAGAAGC
AGAAGCAGTAGCAGCGCCGACGAACAAAGAGAGCAGAGAGAGCAGAAAGAGGAGAGAGGTCATCGGCATGAGCTGAGCGA
CAGTTCGCTGCTGAGCGACGCGACAGAGCAGGTGACAGCGGACGCGAGGAACAGTGGTGGCATCGCAGCAGCAGCTTCGG
CGACGGCTTCGGGCGGCGTGCCGGGCGGCACGTCGAACCTACTGCACCACTTCCACAGCCACCTGGCTCCAGGCTGGTCG
GGGACACAGACGCCGCTGGCAGCAATGGCCGGAGCCCATCTCGGCGGAAGACCGAAGCACCGTCGCAACCCGTCATACAG
CAGCTCCGTCTCTATGGGCGGGCCCGACAGCGTGCCGGCAGCGGCCGTGGCCACATCGTCATCGTCGTCATACTCGTCGG
CAGCCAACCCGGCGCTGCTGCGGCCGGTCTTGCGAGAAAAACACAGCGTGTCGACGCTGGCGCCGACGTCGTCCGGAATT
CCGTCGCGGCCACCGACACGGGACGCCGCCATGGCCGGGCTGTCGGGCAGCGGTGGCAGTGCAGCAGCCGAGGAGACAGC
TGGCGGAAAGGGTCGTCGTGCAGAGAAGACCGAACAGACAAAACAGACAGATCACACAGATCACACAGAAGAGCCGCGAC
GGCCACACGCCCATCGGCCACACGAGCCACGAGCCGAGGACATGCAGGCAGTCTTCCGGATCCGCTATGCTGGCGACATC
AAGTTGCTGCTGACGGCAGACATTCTGCTAGACTATCCGATGCCCAGCTTTGTCGGCATCCCGGTGCGACTGAGCATCAC
CGGCCTGACCTTTGACGGCGTCGGCGTGCTGGCCCACATCCGCAAGCGCATCCATTTCTGCTTCCTGGGACCGGAGGATG
CGCTGGCCGCTGTCGGCGACGACGAGTCCGACGGCATCAGCGGCTGTGACGGTGGCGATGCTGCGGCTGGCGAGGACGAT
AGCAACATGGACGATAGTGGCGGAGACCGTGCGACTTTGTCGTCTGCACGGTTCACTTTGCACGGTGCAGCAGCCCCGAC
ACAATCGCAACCACCGCCTCCGGCAGCGGCGCCACCCAAGCCGCGAACCCGCGTCGGCGGACTGCTGCAGGAGGTCCGTG
TCGAGAGCGAGATCGGACAGCGTCAGGGCGGCAAGCAGAGTCTGAAGAACGTTGGCAAGGTGGAGCGGTTCGTGCTGGAA
CAGGTGCGACGCATCTTTGAGGAGGAGTTTGTGTACCCGAGTTTCTGGACCTTTCTGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62