GenePrediction:GLEAN_1548 Details

Name: GLEAN_1548
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:578981..581134 (+ strand)
Length: 2154
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:578981..579499 (+ strand)
Length: 519
Type: CDS
Source: GLEAN
Position: GCSC_82:579803..580153 (+ strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_82:580397..580653 (+ strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_82:580732..581134 (+ strand)
Length: 403
>GLEAN_1548 class=GenePrediction position=GCSC_82:578981..581134 (+ strand)
ATGGCTCTTACATACAAGCAGTCGAAGCTGGTGCGGGAGTCGATCCCGCACCTGCGCGAGCACGGCGAGCGGATCTCGTC
GATCTTCTACGCGACGATGTTGGATGAGCACCCGGAACTCAGGAGCTACTTCAACACGGTCAACCAGCAGAACGGGCGGC
AGCCGCGGGCGCTGACGACGATTATCCTGGCGTTTGCGACCAACATCTCGCACACCAGCGAGCTGATCCCGCGGCTCGAG
CGCGTCTGTCACAAGCACTGCTCTCTGGGCATCCAGCCGCAACAGTACGCCATTGTGGGCGAGTATCTGATCCGGGCCTT
CCGCGACGTGCTGGGCACGGCTATGACGACTGAGCTGCAGTCGGCCTGGACGGACGCCTACTGCGTGCTGGCGCGCATGA
TGATGGGCCGCGAGTCGCACCTGTATCGCAGCTTCGAGACCTGGCAGGGCTGGCGGCCACTGCGGGTGGAGCGCAAGGTG
GCCGAGTCCGACGACGTCTACTCTTTCTATCTGGTGCCGGTGCAGCCGACGGCGGCCGAGGCAGCCGCAGCAGCCGCAGC
CGCAGCCGCAGAAGCAACAGCCGCGGCCAAGCTGGCGGCCGAGAACAGCAGCAGCCGGCCGAGCATCAGCGGCCATCGCA
GCAGTGAGCACAACAAGCTGCGAGCACGCATGATCGGCGGTCGGAACGGCTACGGCAGCAGCAGCGCCAGCCTGGCGAAC
AACGCGGCCACGAGCAGCAGCGGTCGGGCAGCAGCAGCAGCAGCGGCAGCCGAGGCCAAGAAGAAGAACAGCAATGTCCT
GCCGTACTATCTGCCCGGACAGTATGTCTCGGTGCGGATGCCGTTGAGCGACGAGAGCGCCATGGCGCTATTGGGTCAAA
ACGGTCAAAACGGTCAGGCCCAAAACGTCCAGGACGGTCAGAACGGTCAGACCCAAATCGGGCAGGCGGGCCCAGACGGC
CGCTTCTACCAGGCGCGACAGTATTCGCTCAGCGACCGGTGGCGGCCCAACTGCTACCGGATCAGCGTCAAGCGCGACGA
GGGCACGCGGTTTGCCAACGCGGTGTCGTCGTCGTACTTTCACCCGGGCGTGGTGTCCAATGCGCTGATCGACAGCGTCG
AGGTGGGCGACACGATCGAGGTGTCGCATCCGACGGGCGAGTTCTTCCTCAACGTCGGCGACGTGTCCGAGTTTGAGGCC
GACAGCAACAACAACATCATCGGTAACAACAGCAACGGCCGCAACAGCAATGGCAGCTTGCACAGCAGCCACAGCAACAA
CGGCCGCAGCAGCACCAGCAGCAGCGGCAGTGGCGGCAATTCCAGCGGTGCCAGCAGCGCCCCCCTGGTTCTCATCTCGG
CCGGCATCGGTGCTGCGCCCATGATGTCGATGTTGTGCAGCGTGGCCGTCACGCAGCCACGACGCGCCGTCACATACGTC
CACGGCACCCACAACGGGCCGCCCGTGTTCGACGCCCAGATCCGCGACATCCAGCGGCGCCATCCGCGTCTGCGCACGGC
CTATTTCTACAGCGGCCGTCCAACGTCCGGAAGGGCTTCTTCGGCCTCGTCAGCCTCGTCGGCACACTCGCTGCGTCGTT
TGCGCGTCAGCGGACTCGGCGGCGGGCTCGGCGACTTGGACTTTCACGGCACCTCCTTCTCGGACCATCACCAGTACCAC
CACAACAACAAGCAACAACAACAGCAACAGCAACAGCAACCACAACTGCAGCGTCGCCCATCTTCGCCCAGCTACCTGTC
CGTCCAGCCGTCCACGGCACTCGGATCCCATGGCGTCGGTCGCTCGCAGACATACGAGTTTACCGGCCGCATCGACCTCA
GCAGGCTCGTGCCCGGGCTTGCCGAACCGTCATCGCCCATGTCCGACCATACGGAGTCGCCGCCGACACCCACCAACGCC
ACAGCCGCTGCCCACGGCAGCCTCCACAACAGCGTCGACGACGATGACCTGCTCTATCTCGGCAACAACAGTACCGAGTA
CTTTGTCTGCGGCCCTGAGGCCTTCATGCTGGACATGGCCGTCTGCCTGGTGCACGGCCTTGGTGTCAGCCGAAATCGCA
TCCGCTACGAGCTCTTCTCGACCGGCGACATCGAGACGGCCCAGCAGGACAGCCGCATGTCCTACATCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62