GenePrediction:GLEAN_1549 Details

Name: GLEAN_1549
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:587460..589557 (+ strand)
Length: 2098
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:587460..587529 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_82:587579..589557 (+ strand)
Length: 1979
>GLEAN_1549 class=GenePrediction position=GCSC_82:587460..589557 (+ strand)
ATGAAGAGAAAGGCAGATTCACAGCCGCAAAAGGCGAAGCAGTCCAAGAGGACAAAGAAGGGCAAGTTGTGTGTGGATAT
ATTCTGCTCGACCGGACGACTGCTGACACGCTTGCACAGCCGTCACGGCGGAGGAGGCCAAGAAGAGGTTTCGCAAGGGG
CTCTTTGAGCAGTCGGTGCTGGACACCTCGACGAAAGCATATGCGGAATCGACGCCGTACAAGCATGCGGTGATCCACGA
GCTGGTGGACGACAAGCTGCTGCGGTCGGTGCGCGACGAGATCCGGGAAAACGTGTCGTTCACGCCCAAAGAGACGGACA
TCTACAAGATCCACCAGTCGGGCGACCTGGCCAACCTAGACGGACTCGAGGACAAGGCGCTGGCCAAGCTGCCATCGCTG
CTATCGCTGCGAGATGCGATCTACTCGGAGACCTTCCGCGACTACGTCTCGCACATCACCGGGTGCGGGCCGCTGAGCGG
GCGCAAGACTGACATGGCCATCAACGTGTACACGCCCGGCTGTTATCTGTTGTGCCACGACGACGTGATTGGCAGCCGCA
AGGTCAGCTACATCCTCTACCTGACGGACCCAGACACGCCGTGGCAGGCCGAATGGGGCGGCGCCCTACGGCTGTTTCCC
GTCTCTGAGCAGGTGGGCGACGATGGCGCGGTAGCCAAGACGCCGGGCGCAGACCCCGTCAAGGTCATCCCGCCGGCCTG
GAACCAGCTGAGCTTCTTTGCCGTGCAGCCGGGTGAGAGCTTCCACGACGTCGAGGAGGTCTACCCCGCCGACTCGGCCG
AGCAGCTACGCAAAGACAGCGGTCGCGTGCGCATGGCCATCAGCGGTTGGTTCCACATCCCGCAGCCAGGCGAGGCTGGC
TTCGTGCAGGGCGCCGAGGCGGCCCAGCTCAAGAACAGCGGGCTCATGCAGCTGCAGGGCAACCCGGACCAGCACGACCG
GCCGCAGACCAAGTCGGTGGTGGTGGGCGACAACAGTCAGGCCAGCCACAGCAGCAACAGCCATGAGTTTGACGAGGCCG
ACCTCGAGTTCCTGCTCAAGTACCTCTCGCCAGCCTATCTCACACCCGACACGCTGGCCGGCATGTCGGAGCATTTTCAG
GAGAACTCGAGCATCACGCTGCCGACGATCCTGAACGCCAAGTTCTCGGCGCGCCTGCAGGAGGACATTGCCCGGCGTGA
GGCCGAAGCGGCGACGACAGACGACAAGGGAAAGAAGGGCAAGAAAGGCAAGAAAGGCAAGAAGGATAGACGGGAGGAGG
CTGGCGGCCGCTGGAAGGTGGCGAAGCCGCCACACAAGCATCGCTTCCTGTATGTGCAGCCGGGCGACGAGCCGGAGGAC
TCGCCGTGGCACGAGCTGCTCGACGTGCTGCTGCCGAGCCAGGCGTTCCGCACGTGGCTAGAGATTGCGACGGATACGAC
GGTGACGTCGTATGACCTGTTGGCGCGGCGCTTCCGGCGAGGCCAGGACTATACGCTTGCGACTCAGCACGATGGCGAGG
CGCGGCTGGAGCTTAATATTGGTCTGACGCCGACGACCGGATGGGGTGATGAGGAGGAGGAGGACGAAGAGGAGGAAGAG
GAAGAGGAAGAGAAACAGACAAAAGGAAAAGGCAAGGAAAAGGCCAGCAAGAAGAGTGCTAAGAATGGGGTGAAGAGCAA
GAAGGGCGGAAAGGACGAAAAGGACGAAAAGGACAAGGACAAGGACGAGGATGAGGCGGACAAGGATGATGACGGCGTTG
GCGGCCACGAGGTATATATGGCGGGCGACGAGGACGACACAGAGGACGCAGCTGTGTACCGGACAAGCAGCGACGAGGAC
AACATTCTGTTTTTCCAAGCGGCAGCGTGGAACAAGATGACGATTGTGCTGCGCGACAGCGGAACGCTGCGGTTTGTCAA
GTACGTCAACCGCAAGGCACTGGGCGACCGCTGGGACGTGTCGGCAACGTTTGAAATTGAGGAGGAGGAGGACGGAGAGG
AGGAAAACGGGGCAGACCCCAATGCAGACATTGAGGACAGCTCTTCGGAGGAGGAGTTCCGCGGCTTCTCGAGCAGTGAG
GACAGCTCTTCGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62