GenePrediction:GLEAN_154 Details

Name: GLEAN_154
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1055806..1057271 (+ strand)
Length: 1466
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1055806..1056897 (+ strand)
Length: 1092
Type: CDS
Source: GLEAN
Position: GCSC_179:1056969..1057271 (+ strand)
Length: 303
>GLEAN_154 class=GenePrediction position=GCSC_179:1055806..1057271 (+ strand)
ATGCATCCCAAGTCCGGTAACGCCTCAGCATCTAGCCCCGCGGAAATTATGAAAAGTGCGCAACCCGATAAAAAGAAGCA
TGGGAATCAGAAGAGAGTCCCGAAGAGGTCAATTCTAGACCCGCCAGAGACGCCTGACACAGAGCAGATAGATTCTCGTG
TCGAATCCTTTTCGAAGTTGTTGGAAGTTCCCCAGTCGACCACTGTTCACACTTCAGCTACGAAGCCATTTCTATCGTCT
GTCGTCAAGCCGATGAAAAGAGAGCCGAGGCAGCGAAAGGAGCGCTTTCCTATTGTCATCACTTCCGACTCCGGAGCCAG
TTCCGACGATTATGGCTCGTGCAATGACAAAACTACCTCTATGCTACAGCACTCACGGCCGCCTTTGATAACGACCAGTC
CTCATCCTCAACGGCGGATGAGTCACATTCTACCAGTCGAATTAGAAGAAGAGGCTGAGACATTTAATACAGCATTGAGA
CAACCAAGAACCAATACAAAGCCAAATAGGAATCTGCCGAAACGAGGACGGGCCAAAGCCGCACCGCGCACGCAAAACGT
AGAAAGCTACAAGAAGCGAGAGTTGTCCCCCACTACAACAATTGAAGACATTAGAGAGGGTAAAAAGACAAAACTCGAGC
CACCTCAAAAGCCAGATCACGATGTCATTATGGAACATCCGCAGCCTGTCAAAGTTCGAGAAAACCCGAAAGTGCTACGC
ACAGCGGTAGTCAGTGACCCGTTTTTGGCAAAAAAGGACGACAGCTCCACATGTCTCACTGAGTTCACAGCCAAGCTCCT
CAATACTGCAAGTCGACCAGAAAGTGTCGAGCCAGTGCGATTCCAAGCCGAGTCCACGGCCATACAAACCGGGCTTTTCC
TTCGCAGGATTGACAGCACCCAAGAGCAAGTTGAGCCCAGTGGAATTGCCAGGGAAATGATTGAAGCCCTTGAATCTGCA
GCTCCCCCGAAAACTGGGAGCAGAACACGCAGCTTGCATAAGCGAAGTGGCACCGAATCGGCCAAGGACACCTGGCTGAA
TCAAGCGGATCCATACAAGGCGACCAGCCAGATAATGAGTTATGTTTGCACAGTAAGTTACGCTGGAAATCGTCGTATGT
TATTTCCTACGAAACTAGATCGCCTACTCACCCATCATTCCAGACCATTCTTCGATTCCTCAAGTCGAAAGAGGCAGCCA
TTGAAGACGTTGCTAAAGAGTATCTTCAACGTGGGGAGGTTGTAATCAAAAGAATCAAAACTCTTCATGATAGTGAACGT
GTCGACGTTTGCCGAAAATTTGAGCTCTGTCGACTTGGATCCCTCCACATCTTTGAGGAAGCACAACGAGACATCCGTGT
GATTTCAAGCAAACTTGAGCGCATCGACGTATCCAATTCTGTCAAGAATATGCTCATGGATGATACAGTCTCGCGCCTTC
GGGAATTGCAGGCCAAGATAGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62