GenePrediction:GLEAN_1550 Details

Name: GLEAN_1550
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:590908..593662 (+ strand)
Length: 2755
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:590908..591397 (+ strand)
Length: 490
Type: CDS
Source: GLEAN
Position: GCSC_82:591467..592216 (+ strand)
Length: 750
Type: CDS
Source: GLEAN
Position: GCSC_82:592749..593662 (+ strand)
Length: 914
>GLEAN_1550 class=GenePrediction position=GCSC_82:590908..593662 (+ strand)
ATGGCTGCCCTGCTTGCCTCGCTGCCGCTGGTCGGCCGCCTCATCGCGAGCGCCAGTCCGGCCGTTCAGCTGGTTCCAGT
CGAGGTCCATGCCGTCGAGACCGCACCCGAGCGCCGGCCTCGCACGCTCAAGCATCTCTTGCGGGCCAACCATGTCAACC
ATGCGCTCGTCTACCACGGCAGCCTGCGTCGCTACAACCACATGCCCCATGCCCTCTGCTCGGCCTATCTGCTGGGCGCC
TCGTCCGAACAGCTCAACGCCATCTACGACGTCCTCTCGCGCCAGCTCGAGCCCTGGACCGAGTCGCCCGCCGAGATCTC
CGACCTCGATTGGCGCGACTTTCTCGGCGACCGCCCGTACCAGCGGGCCTACGTCGACTTCTTCGAGGACGTCTACGCCT
CCCACGACGTCGCCTACGACTGGAAGGTCGTCGTCAACAAGTACCTCTTTGCTGGACCGGACCCGCTGGTCAGCAACCTT
ATCAGTGGCCGTGCGTGCTCTCTCTCCTCCCTCGCCCGGTAGCGGTGGCGATAGCGATAGCTTGCTCTAACTCCCCCAGT
CGGCCACCCACTCATCCACCTCGCCTACGCCTTTGAGGTGGACAGCCGCATCATCGCCATCGAAGCGCTGGCCATGTCCT
CTGTCTCGTACGACTTTCTGCATCGCTACGTCGACGAGCCGGCCTACAGCCGGTCTGCACCGCCGAGTCTTGCCGTCGAC
GGCGCCTCGCTCCAGGCCCTGCTGGCCCGCGTCGCCCGAGACAGCCGATTTGACGGCCTGACATCACCGAATCCCAGCGC
AGCAGCACTGCTCTCCGCCAAGGTGGTCAAAGCGGATGCCATGGCCGAGGCGACGGCTGAGGCGACGGCCGAGGCCCACG
CCGGCTTCGGCGAGTTGCTGGAAGCACTCTTCGCGACGCCGGCCGTCGAGGACGCCCTGCTCGAGTACTGGAATGCCTGG
AACGTCGGTGGTGGCGACCTCACGCGCCAGTTCCGAGACCTCCAGGAGGTCGCCGTGGCCCTGCTCGTGGCCACGGTGCC
GCCCAGCACCCACACCTATAACTTCTTCTTGTGCCAGGTCCTGACTACCAGCCATGCCGCCCGTGTGCTGTTGCCACATC
TCCCCGCCCGCTACCACGCAACGCTACTGCGTCAGTGGTGGCTGCTGACGCTGGCCGTGTATGTTTCTGTCCGGCGGCCG
CCAATAGACCTGGAGAACGTGCCGGCCGACCGCGATGGCCGCGGCTGGACGCATGTGGAAGAGCAGGTGCTGACATCGCG
GTGGAGCACGGATGCGCACTATATCAAAGGTCAGTGTGTGTGCGAGAGAGATTGGGACGTAAGCCTGAGCTGACTCTGAA
ATAGCCATCCGAGCGATCAGAGACGCGTCCAGGACCTGGGAAGACGTCCAGGATCGGTTTCTTAATTCAGCCGTGCGCTT
TGTCGACGACTTCCAAGGCTGGACGCGCTGAAATTAGTGGCGGGGCCGAAGGATCAGGAAAGGCGCAGCCACTTGACCTT
TTTGGGACCGATGAGAGGGAATAGGCTGCATTGTACAGTACAAAAGGGCATATCGGCACAGGCGTTTCTTCCTCGTGATG
GGGAAAGGCAAGGCGGCAGCTTGAGCAAAAAGTAATGTTTAGACTTCAAATTACAAGACATATTCTATGACCCGCGGAAC
CAACAAAATCGGGCTACGTAAACATGGACACAGCCTTGTCTCCCACACCAAAAGAAAGTCTTTGGATCCGTCCGGGCTAG
CCGCAAGGCAGACCAGAAGGAGTCTTTTCTGCAAGACTCTTGGTCCCTTCAATGACGGCCTGAGCATTCTTTTCTCCCTA
GCTTTCATCTGGGCCTTCATCAAGCAGATGGCCAAAGCTCCCGAATCACAGCCGGACGGCCTGGATACATGGTGCGAAGG
CAACCATGCAACTGTCGATATCTGCTTTGTGCACGGCCTGGGAGGAAAGCGAAACAGCACCTGGACAGCGTACGGACAAA
CCACGCCCTGGCCAAAGGAGCTGCTCCAACATGCGTTTCCCCGCGCCTGCATCCTGACGTTTGGTTACGGCGCACGCGTC
ACACACAAATTAAACAGTTTGGAGGCTGTTTCGGCAAATCGTGCAACCGACCATGCCTTGAACCTCTTGCAAGACCTGTC
CAACAACCGGGCCGAACGCGGCGCATCCTCTCGTCCCTTGTTCTTTGTCGCACACAGCCTCGGCGGCATCATCTGCAAAC
TTGCCCTGCTCTTGTCACGCCACCACAACGACGACCGTGTGCGCAGAGTCTTTCACTGCATCAAGGGCATTGCGTTCATG
GGCACGCCGCACAAAGGATCAACAATAGCAAGCTGGGCAAAGGTGCCTGCTTACGTGCTCGGATTCTTCAAGTCGACAAA
CACGTCCCTGTTAGACTTGCTGAGACTCGACAGCCAAATGCTCGAGCTGACCCATATCCAATTCTTGAACCTGCTGCGCG
AATTTGACCAAGGGCGCAGGTCTCTCGAGATTACCTGCTTCTTTGAGGAGCTTCCGTTGTTCCCGTATGGACATATTGTC
GCCAAACCGGCTGCTGTCATAGACGGCTACAAATGCATCAGCATTCGCGCCCACCACCGGGGCATGGTGCGCTTTAGCTC
GGCGGATGACGAAGGCTACAAGAGGCTGGTCGACGAGCTGAAGATGTGGGTGCTGAGATCGAGGCCTTGGCCCTTTGCAG
TACCCGACTTGTTGCGTCACCGTGTTGTGACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62