GenePrediction:GLEAN_1551 Details

Name: GLEAN_1551
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:594449..596993 (+ strand)
Length: 2545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:594449..594731 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_82:594787..596993 (+ strand)
Length: 2207
>GLEAN_1551 class=GenePrediction position=GCSC_82:594449..596993 (+ strand)
ATGCCCACCACTTCGTCTTCAAGCTCGACTTCGGCCGAGCGGCAGCCGTTGCTGATGCGACGCACGTTCAGCCACGAGAT
CGAGGCAGAGCCGGTGTACGCCTGCATCGCAAATCCGCACTCGCACCTGCCGGTCTACACCAACATCCACCGCATCCGGC
GCGACATTGTCGCCGTTGTGGAGGACTATCTCTCGGCTGAACAGCTACGGGACATGCGTATCAACATCTCAGTGATCCGG
CCACTGGTCGACAAGCTATACGAACTGGACGACATCTCCATCGGTACGTCCGTTCTGCAGGCCTTCCCCCCCGTTGCCTG
ATCAGCGCTGACCGATAGTCTACTGTCTCCTCGTCAACCGGGCCCAGTTTCTCTACGAGCAGTCGGGCAACAAGAACCGG
CAAAACGTCAACTTCACGCGGGCAGCCCTCTGCGAGCTGATCGCCCACCGGATCCTCCGCCGCTTCAGCGAGGACAACGA
CGGCGTGGCCGGACTGCTGGTGCTCTCGCACATTCTCGTAGCCGGCTTCGAGCCGTTCCAGAACGCGCCTGACTCGGTCC
GACAGGAGGCTTCCCAGTCCGAGTCTTGGCTGTACAGCCGCACGCTGCCGGCGCTCGAGGTGGCCATTCTGAGCGAGAGC
AAGCTCTTTCTCAGCTCGACGGCTTGCCAAAAGGTCATCGACGCCATTTACGTCGGCCGGGTCACGTACACGCCTTCCAG
CTTCATCGACATCATTCCCGACCACTACAAGCAGAAACCGATCGCACTTTACGACCCGCGCGAGGCCTCGCTGCTCAACC
AGTACCGCCTGATCGTGCCGCGGACGCGCAACATCCTCGAGACGCTGCAGTTCAGCGTGCTGCTGGGCCTCTATCTTTGC
TTCATGGCCGAGCGTGACGCCTCCCGCTACAGCAAGCTCGAGATCGCCTTTGCCATCTTCTCCTTCGGCTGGGTGCTCGA
TCAGTTCGCCACCATCCTCGAGCACGGCTGGCACGTCTACACGCAGAACCTGTGGTCCTTTCTCGACGTCATCTACGCCG
CTGTTTACTGGTCCTATCTCGTGCTCCGGCTGCACGGCTGGCGCATCGGCTCGCTCGAGTACGGTCAGCAGGCTCTCGAC
GCCCTGGCCATGGCGGCGCCCGTGCTGATCCCGCGCATCGCCTTCACTGCCATGTCCGACAACCTGCTGTTTGTGTCGCT
GCGGTCCATGGTCGCCGACTTCACCCTGCTGACCGCCCTGGCCATGTGGTGCTTCGCCGGCTTTCTGCTCTCGCTCGCCT
GGCTGGGTGAGGGCCAGCATCCCATCGTGACCATCACCAAGTGGATGGTCTACATCTGGTTCGGCCTTGACGGCACCGGT
ATCCAGCGGTCCACCGAGTTCCACTGGCTGCTGGGACCCATTCTCATGATCGCCTTTGCCTTTCTCGGCAACACCCTCTT
CCTGACGATCCTGGTGTCCATGCTATCCAACACCTTCAGCACCATCGTGTCCAATGCCACCGCCGAGATCCAGTACCGTC
GCGCTGTGCTGACACTCGAGGGTGTTAAGAGCGATGCCATCTTTGCCTACCAGCCGCCCTTCAACATCTTGGCCCTCTTC
ATCCTGGTCCCGCTCAAATTTCTCGTGTCGCCACGCTGGTTCCACAAGATTCACGTCGCCTGCGTCCGTACCATCAACCT
TCCCGTCCTTCTGTTCATCGCCATCGCTGAGCGTCGATTGCTGTGGCCGGCTTCGTACGGCGAAGCGTCCAGGACCGCCA
CGCCATCACGCCGCTCGTTCTGGGACGCCTGGCGCATCACAGTGCACGGCGACATCCGCGCCGTCTTCGACCTGCCGCCG
CCAGATTCTGTCGAGGACGAGATCGCGGCTGACGACGACCTGACGCACCATCTGATCCGCCGCCAGTTTGTTCGGCCGCC
GCAGGTCGTTGCTGACGTCAGGGGCCTCAACCACGAATCTCGTCGGACGTCTGCAGCTCCCTCCAGCGACATTGTCAGTG
GGAAAGACGGTCCTGACGGAAGCACTGGCGACGAATCCGGAACCGGCCGGCTGTCTGTGGTCAGGTTTGCCGAAAGCGCT
GATCTACCGCCATCAGAACCCCGCAAGCGCTCACCACCACCGACGGCGTTAGCACCGCCTCCGACTTTGCGACACAAGCA
TGGCGTCAGTCGGCGGGACAGTATCGCTTTGCCGGGACTTGATCCGGACAAATTGCGGACGCTTCTGGACGAGTCCGACG
CGGACGTGGGCCGGGACACAAACATGGACGGGGACATGCATTCGGACGGGACGAGTATAAACTTTGGTAGCAGTCGTGAT
AGGCGGCTGACCGGAATGCATCGGCGGCTGGGCGAGCTGGAGGAATCCATGGCCCGCATCGAGAGCATGCTCGGCCAACT
GATCAAGCAGACCAGCAGCCCAGACGAAGACCAAGACGTGGAAAGGGCACACGAAGTCGAAGAAGAGGTCATTGACGATG
GAGAGATGAGCGATGCCGAGCAAACAGGCTCCATCGCAGATTTGGACTTGACAACCACCACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62