GenePrediction:GLEAN_1553 Details

Name: GLEAN_1553
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:602790..604951 (+ strand)
Length: 2162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:602790..603320 (+ strand)
Length: 531
Type: CDS
Source: GLEAN
Position: GCSC_82:603390..604010 (+ strand)
Length: 621
Type: CDS
Source: GLEAN
Position: GCSC_82:604067..604951 (+ strand)
Length: 885
>GLEAN_1553 class=GenePrediction position=GCSC_82:602790..604951 (+ strand)
ATGTCCAATTTCGTCCAGCACCAGCAGGTTCACCAGGCCAGCATTGGCCTGATTCCTGTACCACACGGCCCAGAAACGGG
CGACGAGACGGAGAACTACCCCGTTGGTCCAGAAGGCTACTACACCGAAGAGCAGGAACGCGAAATCTTCAAGTATCTGA
CGCACCCCGACGACAGCTTCGACGAGAATGGCACCTACTGGGCCGATCTGAAGCTGGGCAAGCGCATTTCCTTTGTGAAC
AAGGTCAACAACGCCGAGGCCGCCAAGGAGCTCAAGAGTACCTGGCAGCTGTTCAAGACGGACCCTCTCGGCCCCGTCAC
CTGGTATTTCCGCAATGCCGTCCTTCCTGGTGCTGGTCTCGGCCTGGAGGGCTATGTCCTCTTCTCCATTGGCAACCTGA
GCCCGCTCTTCGCTCTCGCCTGGCCTCACTGCTGGGGCTCCAAGAAGGCCCTCGACTGCGACACAAATTGGATTTCTGCT
GTGTCCTATCTCGAAGTCGTCGGCATCATGATCGGCCAGGCCGTCGTTGGTGTATGTTCACCCATTACAATTGCAAATCC
GTCTAGTTCATTGAGCCTTGGCTAATTCTCGTGCAAATAGGTCATGGGTGATTGGCTCGGTCGTCGCTGGGGTCTGATCC
AGGACGCCATGATTATGTTCGTCGGTCTGCTGATGCTCACGGCCAGCTGGGGCCTGACCATGAACGGCTGGGTTGTCTGC
TATGCCTGGTCGCTGTTCTTCTACGGCTTCGGTGTCGGTGGCGAGTATCCCATGACGGCCACATCCTCGATGGAAAATGC
CGTTGGTGCCGGCAAGCTCTCTACCCGTGACGATCGCCTCCACCGTGGCCGCAAGGTCACCATGGCCTTTCTGATGCAGG
GTTGGGGCCAGCTGGCCAACCAGGCCCTGCTCATCATCCTTCTGCTCATCTTCCACCACGGCCAGGGTGACCCGCCGTAC
AGCCTGTCATCCGTTCAGTGGACCTTCCGTCTCTCGTTTGCCTTCCCCGCCGTCGGCACGCTCTGGCTCGTCTACTACCG
TGTCTACAAGATGCCCAACGCCTCCCGCCAGCTCCAGATCGCCAAGAAGAAGAGCAATGTCACCGGCTACGATCTGGCCT
CGCTGCAGATCACTGTCCACCACTTTGGCGGCCGTCTGCTCGCCACTGCCGGAACGTGGTTCTGCAACGACGTTTTCTTC
TATGGAAACAAGCTGTTCCAGGTTCGTACAATGCTCTGGTCGCCCTCTCTGCTCTCTTGCCCTACTAACTCACTCAGTCG
CAATTCATCAGCGTCATCACCGGCGGCTCCAAGAGCGTCATGGTTGGCTGGGTGTGGAACATTTGCAACATCATCGTCTC
GCTGGCAGGCTACTACCTGGCTTCCTTCCTCATTGACAACAAGCTGTACGGCCGCAAGATGATGCAGCAGATCGGCTTCC
TGATGTGCTTCGTCATGTTCGTCGTCCCGGCTTTCCACTACAAATACTACGTCAGCTCCGAGCACATCCATGCCTTCCAG
GCCATGTACTTCATCTCTTCGTTTTTCAACCAGTTCGGCCCCAACTCTGTCACCTTCCTCGTCGCCGGCGAGGTTTTTCC
TACCCCCGTGCGTGCCTCGGCTCACGGCTTCTCTGCCTGCATTGGCAAGGCTGGTGCCCTCCTTGCCTCGGTTCTCTACA
ATTACATCGACATTCAGACCAAGTTTTACGTCGTTCCCTGGTTCGGCCTGGCTGGCATGGTCTTGACCTTTGTCTTCCTG
CCCGACACGACCGGCCTGGACCTGAAGGAGCAGGAGCGGCGCTGGGACTACATCAAGCAGGGCCGTGAGCATGAGTACCA
CGGCATTGCCGTCCACCCTCAGCACCTGTCGCTTTGGGAGCGCATTCGGGGTGTGGGCAAGTACTACGACCCGAAGCTTG
ACCTGAAGTCCAAGATCGAGGACATGCGTGCCGATTGGGAAACTCGCGAGTTTGCCAAGCGCAATGCTGAGCATGAGGGC
GGCAAGGAGCACGGCGATGACGAGCTGACGGCCGAAGCACACCGCTACTTCCAGCACACCAGCAAGGGCAGCCCGCGTCT
TGCAGGCCAGAATGGCAGCGGCAGCGGAAGCAATGGCGTCCTTGAGGATGACTACAACAACGAGAAGGATGCTAGCGCTT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62