GenePrediction:GLEAN_1554 Details

Name: GLEAN_1554
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:605409..608763 (+ strand)
Length: 3355
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:605409..605426 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_82:605555..605639 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_82:605779..605866 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_82:605931..606059 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_82:606127..606313 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_82:606379..606448 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_82:606519..607597 (+ strand)
Length: 1079
Type: CDS
Source: GLEAN
Position: GCSC_82:607672..607842 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_82:607906..607960 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_82:608020..608157 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_82:608219..608763 (+ strand)
Length: 545
>GLEAN_1554 class=GenePrediction position=GCSC_82:605409..608763 (+ strand)
ATGCGGTTGGACGTTAAGGTAAGGTCGACCTGCTCTTCGCTTGACGAAACGCGCGCTATTTAGCTGCCGGCGCATCTTGC
CATCCCCTTGACAGTGGCCCATCCGTTTTCGCGTCTCGCAGCTAACCCGAGGTTCGACGGCCACAGAGAAGCCTCTTCGC
CCGGAGCGAGCGGGTGAAGGGTATTGACTTTCACCAACATGAGCCATGGGTTCTCACGACACTCTATTCCGGTACGCAAG
GCGCCGTTTCTCTCCCTCCCCCCCTTCTGCCAGCCTGATGAATGGGCCTCGATCCCGATTCGGCCAAAGGATTGCTGTCC
AATAGCCTGCTGAGATGCAATTTGTCTGACCAAACAACTGCGATTATCAGGCCAATGCCACATCTGGAACTACGAGACGG
GCCAGATTGTCAAGACGTTCGAGCTCACCGATGTCCCTGTGCGAGCGGGTCGCTTCATGTGAATAGCATTCCTCGTGTCC
TCCCTCATTCGCAGATGCCAGCTGACACGAGACGTCCGACAGCTCGAGGAAGAACTGGATTGTCTGCGGCAGCGATGACT
TCCAGATGCGGGTGTACAACTACAACACGTCCGAGAAGATTACGAGCTTCGAGGCTCACCCCGACTACATCCGTGCCCTG
GCGGTCCATCCGTACGTGTGTCCCTGTTTCCGAAGGCCGTGTATCGCGCGGGGTATAGCTGCTGACCTGTTCCAACAGCA
CCCAGCCGTTTGTGCTCTCTGCCAGCGATGACATGACGATCAAGTGCTGGGACTGGGAGAAGGGATGGAAGTGCATCCAG
GTGTACGAGGGCCACAGCCACTACGTTATGGGACTGGCAATCAACCCCAAGGACACCAGTCTGTTTGCGTCTGCCTGCTT
GGACAGGACCGTGAAAGTGTGGTCGGTATGTGGCCGCTGGCAGCCTGACCTCCGCACCTTGTGGGCTACCAACTGACTCT
TTTGCTGCAGCTTGGATCTAGCACTGCCAACTTTACCCTGGAGGCGCACGAGACCAAGGGCGTCAACTTTGTCGACTACT
GTAAGCTTAGTATAAGGAAGATGGTGGCCGGTGCATTTGACTGTGCTAACGCGGTGCCTCTCGTGCCAAGACCCCCACTC
CGACCGGCCTTACATTCTCACGACGTCCGACGATCGGACAATCAAGATCTGGGACCTGACGACCAAGTCTCTCCAGGCGA
CGCTGGAAGGTCACACGAACAATGTGTCATTCGCGGTCTACCACCCGGAGCTGCCCATCATTGTGTCTGGTTCAGAGGAT
GGCACGATCAAGATCTGGCACAGCGGCACGTACCGTCTCGAACAGTCGCTCAACTACGGACTGGAACGTGCGTGGTGTGT
AACGTACCAGAAGGGCAAGCAGGGCGTCGGTGTCGGGTTTGACGACGGCATCGTGGTGATCAAGATGGGCCGCGAGGAGC
CGGCCATCTCGATGGACGCGTCGGGCAAGGTGATTGCGGCCAAGAACAACGATGTGGTGTCGGCGATCATCAAGCCGGAC
CCGACGGTGAAGGGCAACGAGCCGATCAACCTGCAGACCAAGGACTTTGGGCAGTGCGAGGTGTACCCACAGACGCTGCA
GCACTCGCCCAACGGCCGGTTTGTGGCGGTGTCGGGCGACGGCGAGTACATTATCTACACGGCGCTAGCCTGGCGGCAGA
AGGCGTTTGGCAATGCGCTGGACTTTGTCTGGGGCAGCAAGGACAACAGCAACGACTACGCGGTGCGCGAGTCGGCGACG
TCGGTCAAGATCTACAAGAACTTTGTGGAGAAGAGTGGCGGGCTCGACGTGGGCTTCCAGGCAGATGGACTCCACGGCGG
CATCCTCCTGGGCGTGCGTGGTGCGGGAGGCGTGTCGTTCTTCGACTGGCAGAGCGGCAGCCTTGTGCGCCGGATCGAGG
TAGAGCCGCGGGAAGTGTACTGGTCGGACAGCGGCGAGCTGGTATGTCTTGCGTGCGAGGACACGTTCTACATCCTGCGG
TTCTCGCGCGAGAGCTACGCTGCGGCAGTGCAGGCAGGCGAAGTCGAGGACGACGGGGTGGAGGCGGCGTTCGAGGTGAT
CACAGACCAGAACGAGGCCGTGCGCACGGGCAAATGGGTGGGCGACTGCTTCGTATACACGAACAGCACGAACCGGCTCA
ATTACCTGGTTGGCGACCAGACGTACACGGTAAGTTTGGCTTCGGCTACGGCTTTGGCAGCCAGAGGTGGTGTGGACGCT
GGCTGACTCTCTACGCGCTGCAGATCTCGCACACGGACGTGCCGATGTACATTCTGGGCTACATCCAGAGGGACTCGAGA
ATCTACCTGGCCGACAAGGACATCAACGTGACTTCGTTTGCGCTTTCCGTCAGCCTTCTCGAGTACGAGACATGTGTTCT
TCGCGGCGACATGGACGCAGCCGCAGAGCTACTTGTACGTCTTGGCGATGCGCAGTGTGTCCTTGCGGTTTTAGTGTTGT
GTACTGACGAGCTGTAGCCGACGATTGAGGACAGCCAGATGAACAAGGTGGCCCGCTTCCTGGAGGGACAAGGTAAGAAG
ACGATGCGGGCCGATGGATGCGAAGACGGCGCATGCTGACTAATCATTTAGGCCTCAAGGAGCTGGCACTGGAAGTGGCA
ACGGATCCAGACCAGAAGTTCGACCTTGCGCTTTCGCTAAATCGGCTCGACGTTGCGCTGGAGCTTGCGCGGACGGCCGA
CGTGGAACACAAGTGGAAGTCTGTTGGTGGTAAGTGAGGCGTCGAATATGACGGACGAGGCTGTGACTGTGGCTAACGAG
GACCTTGCAGATGCGGCATTGACAACATGGGATGTGACTCTTGCATCGGAGTGCTTCTCGCACTCAAAAGACCTGGGATC
GCTTCTGCTGCTGCACAGCTCAACGGGCAACCGGGAGGGTCTGGCAGAGCTGGACAAACTGGCGACGGAGGCTGGATCGT
ACAACGTTGCTTTTACGAGCCGGTGGCTCTTGGGCGACGTGGATGGCTGTATTGAGACGCTTTCAAAGACGGGCCGGCTC
GCAGAGGCAGCGCTGTTTGCACAGACGTACAAACCCAGCTCGGCGGCAGCGGTGGTGGGCGAGTGGAAGCAGAGCCTGGA
GAAGGCGAAGAAGGGACGGGTTGCCAAGCTGATTGGGGTTCCGGGCGAAGATGAGGAGCTATTTCCGGAATGGAACGAGT
GGCTGCAGCTGGAGAAGCAGGGGAGCTTGCCGGCAGAAGGGAAGCTCGTGGGCGTAGAGGAGCCTGCGGAGAAGGAAGAG
GAAGAGGCAGCGGAAGAGGAGGCAGCAGAAGAAGAGGCAGAGGAAGAGGAGGAAGAAGAGTCTTCGGATGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62