GenePrediction:GLEAN_1555 Details

Name: GLEAN_1555
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:609163..610913 (+ strand)
Length: 1751
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:609163..609190 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_82:609251..610555 (+ strand)
Length: 1305
Type: CDS
Source: GLEAN
Position: GCSC_82:610641..610714 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_82:610824..610913 (+ strand)
Length: 90
>GLEAN_1555 class=GenePrediction position=GCSC_82:609163..610913 (+ strand)
ATGACGAAAGTATTCGACGCCGCGGAAGGTAGGCAAGGGAGCGAAAGCGAGAGGTGGCAGGCAGCAGTCAGTAGCTAACG
AGTGACAGTGGCCAAGCACTCGACGGCCGAGAGCTGTTGGGTGGTGCTATACGGCAACGTGTACGATGTGACCGACTTTA
TCCCGTCTCATCCGGGCGGCTCGCGCGTGATTCTGCAGCTGGCGGGACGCGACTGCACGGCAGAGTTCGACCCGATCCAT
CCGCCGGGGACGCTGGACGAGCTGAAGCCGGAAGCGAAGCTGGGGACGCTGGACGTGGAGAGCATAAAGGTGGGAGGGGG
GGATGACGATAAAAGTGCTCCCAAAGACGACGAGACGTATCGCCCCCCACCGCTGGAGTCGCTGCTGAACCTGGACGAGA
TGGAGACGGTGGCGACGAAGCTGGTGCCGCGCAAGGCGTGGTCGTACTACTTTTCGGCGGGCGACGACCTGCTGTCGAAG
CGGCTGAACCATACGGTCTTCCAGCAGATCCTGCTGCGGCCGCGCGTCTTTGTGGACATGACGGCGTGCTCGACGACGAC
GACACTGCTGGGCGGCCAGCTGGCGGTGGGCCTGCCGGTATTTGTGTCGCCGGCAGCGATGGCGCGTCTGGGCCACCCGG
ACGGCGAGGCCGGGATTGCGCGCGGCGTCTCACGGTTTGGGGCGTTGCAGATCGTGTCGCACAACGCGTCGATGACGGTG
GAGCAGATCGTGGCGGACGCGCTGCCGGGACAGCTCTTTGGCTGGCAGATCTACGTGCAAAAGGACCGGCGCAAGAGCGA
GGCGATGCTGGCCCGGATCAACGGCCTGTCCCAATACTACCGCTGTGTGGTCCTGACGCTGGATGCCTCTGTGCCGGGAA
AGCGTGAAGACGACGAGCGACAGCAGTTTGGGACCGGAGCCAGCTTTGCGGCCGCTACCCAGGATGTCGGCAGCCAGCCG
GCCGGGGCCGGGATCGGACGGCAGATGTTCTTCGGCACAGCCACCGACATCACGTGGCAGACCACGCTGCCCTGGCTCGC
TGCCCACACGTCGCTGCCGATCGTGCTCAAGGGCATCCAGACCCACGAAGACGCCTGGCTGGCGGCTCGCTATGCGGCCG
CCCATCCCGGCTCGGTCCAGGCCATCATCCTGTCGAATCACGGCGGCCGCTCGCTCGACACGGCTCCGCCGGCCATCCAC
ACGCTGCTCGAGATCCGCAAGTACTGTCCGGCCGTGTTCGACCACGTCGAGGTCTGGATCGACGGCGGCGTCCATCGCGG
CACCGACGTCGTCAAGGCTCTCTGTCTCGGCGCCAAGGCTGTCGGTGTCGGTCGCGCTGCCCTCTGGGGCCTCGGCGCTG
GCGGCTGGCGTGGCGTCGACCGTACCTTTGAGAGTGAGTGCATGTGTTCCGGTGTCGCGCTGTCTCCATCGCTTGACCTC
GTCTCCGTCGTACGCCTTCTTCTGACCTCCTTCACCAGTCCTCTCCGACGAGATCAAAACCTGCATGCGTCTGCTCGGCG
CCACCTCCATCGCCGACCTCAACCCACGTCTGGTGAGTGTCAAACCACACGGCTCTGCCAAGCTGCCCAATCCCCCAATC
CCCCAATCCCCCAATCCCCAACCCATTCTCCCAACACCCGTCATCATCCGCTGACCTTCAGGTCAACACACGTGCTGTCG
AACGAGACATCTTCGACGGCGGGGCTGGCCTCAACGAGCTCGGCCTCCTCCCCGTCAAGGCTAAGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62