GenePrediction:GLEAN_1556 Details

Name: GLEAN_1556
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:613446..614678 (+ strand)
Length: 1233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:613446..613606 (+ strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_82:613665..614089 (+ strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_82:614160..614284 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_82:614355..614678 (+ strand)
Length: 324
>GLEAN_1556 class=GenePrediction position=GCSC_82:613446..614678 (+ strand)
ATGGACTCCGACAAGAGAGACGAGGACACCTCGGTCCAGTACACCGAAACGGCGGTCGGCCGGCCGTCAAAGAAGAGTTT
GTTGATCGCACACGTGAAGCGGTTTTGGTGGGTGCACCTGCTCATCATCTGCTGCATCGTGGCGCTCGCCGTCCCTCTCA
CGTAAGTACCATTCGCGAGACCTCTCGACTGCCACCCCTCTGCTGACTGGCCGTTGCAGCATCTTTGTCGGCATCAAGCA
CCTGGCCCAGAGCCAGCTCAACAAGGCCACCCTGGCCATCCAGGGCATCACCGTCACCAATTCCACCACCGAGAGCTTCC
ATATGGCCATCAACAGCACCATCAAGGGCACCAAGACCAAGGCCACCGTCCACAGCTTCGTCGGCGCCATGTATCTCGAG
GACGAGCCGGGCCACGTTCCCTTTGCGCACATCAACTTCCCCGAGACCAAGAACAAGCCGATGCAGTCGGTCAACATCAG
CCAGCTTGTCCCCATCGAGAACTTGGCTGCCCTGACCACCTTCAACTCCTGGATACTCGCCAATGAGTCGGTGCGCGTCA
CTGTTGACGGCAACACCACCATTAATGTGCCTGGTATCAGCCACAAGTACCACGTCCACTTCCACAAGATCCTCACCCTG
ACCGGTATGTTCATCTTCCCTTTCCGTCTCCTCTGGTCTGCCCAATGTGTTCCCACCTAACCGCTCTCTCTCAGGCCTGG
ACAGTTTCTCCGGCATGTCCGTCGCCAACTCCTCTGTCACCGCCAGCAACTTCTCTGACGGCAGCAACTTCCACACCACC
GTCACCATCCCCAACAAGTCGGTGCTCAGCTTCGAAATCGTGAGTCCAAAAGGAGACAGTCCCCCAGAACGCTCCTCTAT
CCCAGTCCCACTTGCTAACATCTTACAAGGGCAACGCCACATTCAATACCTACTTAGAGGATACGTATATCGGCCCAACC
TACATTAACAACGTCTTCCTTCACCAGGGCGACAACGTATACCCCCTCCACTCTAAATTAGCAGCCATCCCCGTCCTCAC
AGCCCTCGACTCCGAACCGTACTGCGGCAACGGCACGCTGCCCATCACCATCTCTGGCAGCACTGTTAGCCGCAACGGCG
AGAATCTGACCTACTACTCCGATGCTCTCGCCTCATCCAACGACACCGTCCAGGTCCCTCTGGCCGATGCTTTCAAGGCC
ATCGGCATCAACGCCAAGTGTCCGAGCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62