GenePrediction:GLEAN_1557 Details

Name: GLEAN_1557
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:616404..617349 (+ strand)
Length: 946
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:616404..616433 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_82:616496..616643 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_82:616697..617349 (+ strand)
Length: 653
>GLEAN_1557 class=GenePrediction position=GCSC_82:616404..617349 (+ strand)
ATGGATCACCGCCCACAAGCTTGGGGTCGGGTATGTTTCCCATGTCGTATAGATGGCCTCGCAGTTCCCTCTTTCTGACC
TGTCTGCCACAGCCTCGCGACGACGTCTACGGGGCATATGATGCCTCGTACCTGACCAGCTCTGGTCCGAAGCAGGCCAC
ACAGTCGCCCATCGTGACGGGCACATCGGTAGTAGCGCTCAAGTTCAACGGCGGTGTTGTCATGGCAGCCGACAATCTTG
GTGAGTTTCCGTGTTGGATGCCCGGAACGGCTGCCGGCTGACGTTCCCTCCAGCCTCGTACGGCTCGCTCGCACGGTTCA
ACAGCACGCTGCGGCTGCGGTCGTTTGCCAACACGTCGGTCATTGGCTTCAGCGGCGACGTGTCGGACATGCAGTACCTC
GACCGTCATCTGACCGAGCTCGCCATCGACGAGACATACGACAACCCGGCGCCGAGCGCGGAGGAGCGCCAGGACGACGA
CGGCGAGATAAAACGGAGCAGCACCCTCAACGCCGCCAACCTGCACAAGTACCTCGCCAAGCTGATGTACCAGCGCCGCA
ACAAGTTCGACCCGCTCTGGAACCAGCTGCTGGTCGCCGGCCTCGACGACGAGAGCAAGCCGTTTCTCGCCTGTGCCGAT
CTGCGTGGCACCACGTACTCGGCCCCCAGCTTGGCTACTGGCTACGGCTCCGCTCTCGCCCAGCCCATCATGCGCCGCTA
CGCCGAGACGGACGAGCAGACCGCCAAGCTCACCCGCGAACAGGCCGTCGACATTGTCCGCGAGTGCATGAAGGTCCTCT
ACTACCGCGACGCCCGCAGTCTCGACACCTACAGCCTGGCCATTGTCACGGCTGCCGGCGTCGACATCAGCACGTCCGAG
AAGCTCGAGGCCCAGAGCTGGGCTTTTGCAGACCGTATCCGCGGATACGGCACGCAGGTTGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62