GenePrediction:GLEAN_1558 Details

Name: GLEAN_1558
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:634580..635568 (+ strand)
Length: 989
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:634580..634784 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_82:634850..634907 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_82:634962..635165 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_82:635238..635568 (+ strand)
Length: 331
>GLEAN_1558 class=GenePrediction position=GCSC_82:634580..635568 (+ strand)
ATGGCCGAACGCCCGCTGCGCATCCTCTGTCTCGGAGACTCGCTGACGGCCGGCTATACGCAGGCCGGTCTGCTCTTCCA
CCCGTACCACCATGCTCTTGTGCGGAAGCTCAAGGCCGCCTTTCCCGACCTGGAGGTCGACGTGGTGGAGGACGGGTTGA
GCGGCGATGTCTCGTCGCACTTCTCTGCCCGCCTCACGGCTGCATGTGAGTTCTGGGCAGCTTTCGGCCCCGCATGGACG
CCTCCACAGCTGCTGACCGGCTGCCCATAGTTCGGGCTAAGAAGATGATGAGGCCGTTCGACTGGACCATTGTGCTGGGA
GGGACAAAGTAAGAGAATCTGCCACGGACAGGCTGTCGTGTGTGCTGGCTGACTTCCTGCAGCGATCTCTGCTCTGGTGC
GTCGCCGGAACAGACGTTTGAGAACCTGGAGCGCGCCTGGTCCAACGGGATTTTGCGGAGGAGCAAGGTGCTCGCGCTCA
CGGTGCCGGAGATGGCGACGACGTCCAGCTCGCCTGTGGTTGCAAGCATCAATGCGCGCCGAGACCGGCTCAACGCTCTT
GTGCAGGGCTACACGCACGAGGACTAGTATGCTTTCCCTTTCTTTCAGACCTTCTTTCCCTTTCCCAACGGCTGCAGAAT
CTAACATCGGACTTGCAGCTATTCGTACGACTTCAAGTCGGCGTTTTCTTACACGGCCATGTCCGAGGAGGACCGCAAAC
GGTACTGGGACGACACGCTGCACTTCACGCCAGCCGGCTACGACCTCATGGGCGATAAGATCGGGGCGGCGCTGGTGGAC
ATTCTGCACCGGGAGGCGGACGCACGGGAGCAGGACCAGCTGCTGAACAACGGGGTCGAACAGGGCCGACAGCGGCTGCG
TCGAAAGAGGAAGTTCAAGGGCGACGAGAACAGCTTCGAGGAGGAGAGCGGCAGCCCTGGAGATCTGCGGCGGGGATACG
TGGTGGTGCGGTGCAAAGACCTAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62