GenePrediction:GLEAN_1559 Details

Name: GLEAN_1559
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:640417..640903 (+ strand)
Length: 487
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:640417..640440 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_82:640562..640742 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_82:640830..640903 (+ strand)
Length: 74
>GLEAN_1559 class=GenePrediction position=GCSC_82:640417..640903 (+ strand)
ATGTCGACCAGCGCAGGCGTCAACGTATGTCGTGCTTCTTGTCCGAGCAGCCCATTGCGGATGCACACGGAATCCACCGT
TGGCGGAAGCCCGGTCTGGCCGATGCTCTGAATGCTGACACGTCCTTTCTTTCCCCCGCCTGCAGGTTCTCCGGTACTCG
GCTCTCGGCTTGGGCGTCTTCTACGGCTTCTACCACCAGCGGAAGATCTACTCGGCAGATAAGGTGGCTGCTGCAAAGCA
GGAATACGAGCACAAGCAGAAGCTCATTGAGCAGGCCAAGGCAGAGTACAGCAAGTCGAAGCTGCCGCCATCATCAGGCA
GCGGACGTGAGTGCTTACGAAGTGGGGGGAGAGAGACAGAACAGAGACAGCACGAGAGGGGTCACTTGGACTACCCGCTA
ACCTCGACAACAGTGAACCAGGACCCGACGGACCCCAAGTTCGACCTCGAGGCATACCTGGAGTCGTTGGCAAAGGCGAA
CCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62