GenePrediction:GLEAN_1560 Details

Name: GLEAN_1560
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:642395..645111 (+ strand)
Length: 2717
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:642395..643487 (+ strand)
Length: 1093
Type: CDS
Source: GLEAN
Position: GCSC_82:643987..644100 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_82:644177..644267 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_82:644336..644609 (+ strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_82:644665..645111 (+ strand)
Length: 447
>GLEAN_1560 class=GenePrediction position=GCSC_82:642395..645111 (+ strand)
ATGTCGTCGACTGCTATCGCAGCATCGCCTGACCCGTGCTGCTATACCCACGATGCCGACGACCACAACGATGCCGACCT
GCCCTACAACCGCTGTGGCCGGCCGCCATTTGCCCGGCCGTCGCCACCTCAGCCTTTTCGCTTCGACACGGGCGTCGGCA
TGTTTGCGAAGCGCACACCGCGGCCGTTTCCCCCGCCGTTCTATTCGCCCCCGTCCGCGTCGTTCTCCGATCCGCTTAGC
ACGCACCATCTGAGTCGGGACCGTCGTCGAGCCGTGGTCGGCGGCCAGCTGATCGGTGGCTGCACCAACGGCGATGATGC
CGTCTATGCGAGCGAGTATTTCGTCGCGGCCAACGACGGCGTGGGTGCCTGGTCGACACGGCCGCGCGGCCACGCTGGCC
TCTGGGCACGTCTGGTCGCCCACTTCTGGGCAGACGCCGTCTACAACGACCTGCGGGCGGCCGATGCGATGCATATCCCT
CCAGACCCCGCCCGCTGTCTGCAACAGGCATACGAACAGACCATGGAGGCAACACAGGCGCCCAACGATTGGCAGGGAAC
CACAACAGCGACCGGTGCACAGCTGTCCTACCATCGACCGGAGCCGACGAGCAAAGGCGCCGCAGGCGGAGGTGGAGGCG
ATGGGAGGAGCAAGTACGAACCGATGCTCTATGTGACCAACCTGGGCGACTCGCAGGTAATGGTGGTGCGGCCGGCCGAA
AGCCTGATGGTGTTCAAGACCAAGGAGCAGTGGCACTGGTTCGACTGTCCGCGGCAGCTGGGCACCAACAGCCCGGACAC
ACCGCTCAGCAACGCCGTGGTCGACACGGTGCCAATTCACGTCGGCGACGTCGTGCTGGCCATGTCTGACGGCGTCATCG
ACAACCTGTGGTCGCACGAGATTGTCGAGCGGGTAAGCCGCAGCGTGGCCACGTGGCAGGCCCGCGAGAAGACAGACCTG
GACCTGGAGCGCGGCATGATGGCTGTCGTGGCCGAGGAGCTGGTAGAGGCGGCGCGTGTCATTGCCGTCGATCCGTATGC
CGAGAGCCCTTATATGGAGCATGCCATCGAGGAGGGTTTGCCCAGCGAGGGAGGTAGGTCAAAAGCCCATGCCACAAACG
CGCCCATGACTGGATGTTGCGGCTGACGAGACACACAGGCAAGCTCGACGATATCAGTGTTGTGGCGGCGATATGCCGGC
GTAACGACGCGGTGTGAGAGAATTTACAGGTATTGGTCCGCATGTTATAGCGACTTGTTGCGGAATCACACGGCTATCTC
GGTTATCTAGAATGGGTATTTTCGGGGCGTCGCATGGCTTGTTTAAATGGGGGTGCAAAGCATAGAATTACTCGTGCGTT
GATGCACACTAACACGGAACCATCTCGCTTTCCGCAAGCTGGGGTGGGCATCCCGATATAATAGAGTATGGAGAACGAAC
GACCCGATGTGGGAGTATAAAAGCAGAAAGAATTGGGGCCCGGAGTAGTGTGAATAAGCGGGTCTCCGATAAGGAACGCA
TCTGGCTTATCGGACAAGAAAAATTATATGGGCAGAATTCCGGCCTCTGTTCATCTCTCGCCTTGCATCCAGACAGCTCC
GAGGCAGACAAGGACAGGATGCGTGCCAAACGATCCAAGCAGTACAAGAAGCTGGTTCAGCAGTTCAATCTGCACCATGG
ATTCCGCGAGCCATACCAGGTGTTAGGTAAGCGATCGGCTGCGACCAGGCCGATGTTTGTGGGTGCCCAGCTAACTATCT
GGCTTTCTGTTCTTTTCCGCAGTCGACGCCGACCTCGTCCGCGATGCGCAGCGCTTCACCATGGATCTCCAGGCCGGCCT
GGAGCGGACTCTCCACGGTAAGGTGAAGATCATGTAAGTCTGCGCCGACATGTCGCACAGCCTGCTCACCCTGCTCACCC
TGCTTTTTTTTTACTCGCCAGGATCACCCAGTGCTGCATCCGCCACCTGTACGCGCAGGGCCGTGAAGACCGCAGCGTCA
ACAAGGCCATCGATCTGGCCAAGACGTTTGAGCGTCGCCGCTGCGGCCACAAGCCGGAGGAGTTTGAGGAGCCGCTGTCG
ACGCTCGCCTGCCTCGGCCACGTGGTGGACGAGAAGGGCCGCGGCGAAAACAAGCACCGCTACGTCGTGGCGAGCCAAGA
CCAGGATGTGCGGCGGCACATGCGCGGCATCGCCGGCGTACCGCTGATCTACATTGTACGTTGGATGAAGGCGTGGCAGA
ACGGAAGAACGGCAGCACTAACACAAACAGTCGCGGAGCGTGATGATCATGGAGCCCATGTCGGCCCCCACGGCAAAGGT
GGGCGTCCAGGCCGAACGAGCCAAGTTCCGGAGCGAGCTGCGCAAGTTGACGGGCGAGAAGCGCAAACGGACCGACGACG
ACGACGGGACCGACAGCGACGCCAGCGATGCAGACGACGACAAGGACAACAAGGATGACACGGAGAAGAAGAAGAAAAAG
AAGAAGCAGTACGGACTCAAAGCTCCAAACCCGCTGTCGATTAAGAAGAGGAAGGACAAGACGACGACGACGGCGACTGC
GCTGCCAAAGAGTTCGGGCGAGCCGGCTGCCAAGACCTCGACAGACGATGCGGCTCCCAAGCGGAAGCGGAAGCGCAAGC
ACAAGCACAACAGCGCGACACCCGCCGAGGCCGGGGCGGTGCCTGTGTCTGCACCTGCGGCCGTGTCGGATGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62