GenePrediction:GLEAN_1561 Details

Name: GLEAN_1561
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:646002..650374 (+ strand)
Length: 4373
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:646002..646014 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_82:646209..646289 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_82:646352..647355 (+ strand)
Length: 1004
Type: CDS
Source: GLEAN
Position: GCSC_82:647429..650374 (+ strand)
Length: 2946
>GLEAN_1561 class=GenePrediction position=GCSC_82:646002..650374 (+ strand)
ATGCCCCCAACAGGTAGACCAGCCTCGTACAACGCGCATTCACTCGCTTTGCACGGGTATGCTATTCGGCGCGCTTGTCG
CTTCTGCATGCAGTAGACAATTTGCTTCTCTGTCTCGTTGAGAAGCCCGAGACTGCTTGTCGTCGACGCCACCGTCCGTC
CAACAACTCCGCCGCCGGCGCATCACAACCACGACGTCCCCGACCAGACGGCGGCTGCAACGGCGCGCCGTTCCCGTGGG
AGGCGCCAGTCCAGATGGAGAATGAGCTGTCGCAGCCGACTCAGCCAGGTTCGTTGTGCTCTCTCCTCTCCTTCGCGTGC
GCAGAACGCACTGAGCTGACATCCGAACAGCTACCCAGAATGTCCTCGACCCGCGACGTCTAGGCCAGCAGAACTCGGGA
TTCACAGACGAGGATATCGCCGATATCGTCTGCATTCTGGTCCCGTACTCGCCAAAGACTCGCAGCGAGGCCGCACGCCT
GGCCCGCCAAGGCTCGCCCTTCATCATTGGCCGTGAGGATGCTGAGAACGTCGATGTCGACTATCCCTTTGACGATTCTG
CCGGAAACTTCTCCCTCACGTCGGCAGACCCAGGGTCGGGCCCGGTTTTTGTGCTGAGGCTCTCTTCCACCGTCAAGAAC
CCGCTGCAGGGCTTCACCTTTGGCCGCAATCCCAAGAGCTGCGACATCTGCTTTGACAGCGACTCCCTCCGCCGTCTCAG
CAACATCCACTTCCGCATCTTCATCAACGAGTATGGCGTCTTGATGCTCCAGGACCAGTCCACCAATGGCACTGCCGTCG
ACGAGGTCATGCTCAAGGCTCGTCGCAGCAACATGTCCAACATGCGAACCCTCAACAGCGGCACCAAGATCTCCATCCTC
CTGCAGAACAACGCCCACGACTTGGCCTTTCTCGTGCGCGTCCCTCGCCGTCATGGCGAGTACGAGACTGCCTACCAGCG
GAACTTGGCCAACTATCTCCGACACCTGTCTGAGCTGGCCGACTCCGCCGGCTCTGCTGCGACTCCGAATGCGGGTCTGC
CCCCCACCATCGGTGCAGGTCAAGGTGGTCATGTCGATCTCTTTCCACGACCAGCGCATGCTTCGAACATGCCACCTCCG
AGGTTCGTACCGGCCTCCACCAACGGCCTGCCCCGTGAGTGGAACGGCTCCAACAAGTACAACCGTGTCGGCGAGATCGG
GAAAGGCGCATTTGCTACCGTGCACAAGGTCACCTCCAAGTATGATGGAAAGCCATATGCTGCCAAGGAGCTTGACAAGC
GCCGCTTTATCAAAAACGGCGTCTTGGACCAGAAGGTCGAGAATGAGATGAAGATCATGCGAAGTATCCAGCACGTAGGT
CTCCCAGATCCCCTCACAGACTGGCTCTGGCTTCAGGCTGCTTGCTGACTTCGGTTCTGTCATTCAGCCTAGCATCGTGC
GATATGTTGATCATTTCGAATTTGACGACCGTCTCCTCATCATCGTCATGGAGTTCGTGCCGGGAGGCGACCTCGGTAGC
TTCGTCCTCAACCGCGGCGCCCTGTCTGAAGATGCTGTCAGAGACATGGCCAGACAGCTGCTCGAGGCTCTTTCCTATCT
GCATCGCAAAAACATCACTCATCGGGACATAAAGCCAGATAACATCCTCATCGAGTCCGAGTCACCCTTCACCGTCAAAC
TGACCGACTTCGGCCTGTCCAAGATGGTAGACAACGACCAGACCTTTCTGCGCACATTTTGCGGGACCCTCCTGTATTGC
GCACCCGAGGTGTATGCCGAGTACAGCGAATACGACGAGCATGGACACAGGAGTGACAGAAATCGACAGAATCGCCGGCC
CACTGGCCAGCGGTATGACCATGCTGTCGACATATGGTCACTAGGCGGCGTGCTCTTCTACTGCCTCACACGCAGTCCTC
CCTTCCCAGCTGCGAAAAGCACCAGCTATACGGCGCTTCTGCAACGGATCATGACGATGCCCCTTGACACCAGGCCGCTG
TACAACGCCAAAGTGTCAGCCGATTGTGTTGACTTTCTGTCCAGCATGTTGCAGCGCCGGCCGGAATATCGGGCCACAGT
CGACTCCTTGCTGTCGCATCCTTGGCTGACTGGCACCGACATATCTGCCGATGTCCTAGAGCAGAGCGCATCACAGCTGA
GCATCCATGACAATGCAGGCCTGGCCGGCCAGGCAACCGACACCGCTCTGGGAGGACCGGAGAGCGATGACGAGATTTTC
GATGACCTGCTTGGCGGCGAGAGCCAACTCCTGCATAACTTCTCTCCCGACTACGGTGATGAAGAAGAGGATGATGACGA
GGACCGCCTTCAAGAAACGGTGCGTCCGAAACAACGCCTTTTTGGCGAGGTCAATGTTTCCATTATCGGCAGCTCTGGGG
TCTTCTCTGAAAACAATCTCAATCTGCCCATCTCCGGTCTTGGATCGCAGGCCGACAACGAGCCGGACAGCTTCTCATCC
AGACCGTACGGCAGCTTTGATCCCGACGAGACCTTTCTCACTCCGAGGCCGAAGCAGAGGCCGCAAAATATTGTCGTTGG
CGGAGCAGGCAAAGATGGCAGTGACAGCAACGGCAATGTTCCTGCGTCATTGCTGTCCCGCAACCTCGAAGAAAGCCACT
CGGTGGACCAGCTGAACAATCTCACCTTTGATGTGGCATCACAGAGCCTTGGCGGTGCTGAGTCGATCCTTGGGAACCTG
AACATGAAATCGTTGGCCACGTCAAACTTCAAGCACATCGTCACCGACTTTAACAGCAGCAAAAGGAAAACTGCTCTCGA
CACAAGCGAGGAGCTTGAAAACACGCCCCGGCCAGACAAGCCGACGATAAAGCGCCTCAAATCCGACGCTCGTATCCAGT
CCTCGGTCGACAACATGCATGGTGAAGAGGGCGAAAGTGTGTGCAGTCGTAACGGCTCCGACGACGAATATGATGAGAAC
GAAGATCCAGAGTTGTACGCTGCCGTCCAGCCTATCAGCCGATCCAAGACAGGGCGCCAGATGGATCTGCCCGTGCACAA
GTCAGTGTACTGGATCCCAGGCGAGCCGTCCAGTTTTCACCTCCAGTATCCGGAAATGACTCAGCTGCAGTACGATGTCT
TTGAGGATGCAGCCATTACCAGAAAAGAGGAGTTTCGACCAGGTGGCTCGCGGCTTTGGGATCTCGCCATGAAACATTTT
GCTCCAACAACGGTAGCAGCCAGAGAAGAGCTGGATCCAACATACTCTCGCTCACCCTCAGAGTTGTCCGACACCCCTGC
TCCACCTGACAATGCAAATGGCGAAATGAAGGAGAACATGATATCACGAGCCCCCACGGTTTCGCCTAGCCGAGAAAGCA
CACCTGCCCGAGATCTGTCGCCCACTCCACAACCACAAGCGCAGTTGCAACAACATGCTCAGGTTGTCGTACCTGCCATA
TCCAAACATGACTCTCCCGTTGCCTGTTTTGATTCAGTACCAAAATCGGTCGTACAGAACATCGCGGTACCTGTCACAGA
CTCAGTGACCACCTGGGGTCGACACCCTGATAACACAAACATCTATGTGCCCAAGACCGAGCTCAAAGTGCCAAAGTACG
CCCTGAAACTTCTTCTGTGGCGCAGCAGCAGCAGAGTAGGGGCCGGTGCCGGCGAGGGTGATGGCAGAAGTCACAGTGTC
GGATATGAGCCGTGGAAAGACTTGCAGCCCTGGAACCGACTGGATACAGCAACCGAGGCAGCGAGCCGGTATCACTTTTA
TATTTCCACCAAAGCGCGGGGCGGCATTTTCGTCAACCAGACGCCCATCAGTTCATTCGACCCCGGCCAGCCGCGAACTG
CTTCGAAGCACTGGACGCGACTATATGACGGTGACTCGGTCGTTGTCTGGCACAACTACCTCGGTCTGGACAGCCATGGC
AGTGCTGGCGGAAACGGAAACGGCAACAAGCTGCGCACGGAGCTGGTGTTCCGATGCAGCTGGGGTGGGTCGGCTGCACG
GCGACCATCCTTTGTGCCTGTTGCGCTTGTCGATGAGGCAACCAGTCGACAGCTGGACGACGCGTGTCTTCGGGCAGAGC
ATTCCGTGTCGCAAAAGGCTGAAGAGCGTCGACGCATGCCGGCGGCCGACCGCGATCTGTGGGAACGGCAGATCCGCATA
GACGAGGAGCGGCAGCGGTCGGTGATCTTTGAGCGGCGTCGTGCAGTCATCTGCACGCGTTATCAGCAGCAGCAGTTGCA
GCAGAAGAAGCACCCTCAAACGGCTGTCAGCCGTCCGATGCTGCCAATATCGCTGGCCAGTGCGCCGGCGGTACTGGGCC
ACGGCGGCGCCGGAAGCGTGCTCGCTCAACACTCTCAGACCGGCTGTGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62