GenePrediction:GLEAN_1562 Details

Name: GLEAN_1562
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:659776..663671 (+ strand)
Length: 3896
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:659776..662106 (+ strand)
Length: 2331
Type: CDS
Source: GLEAN
Position: GCSC_82:662166..663671 (+ strand)
Length: 1506
>GLEAN_1562 class=GenePrediction position=GCSC_82:659776..663671 (+ strand)
ATGGCGGCCGCCGACGAGCCTAGTGCCGACAACGGCACCCACCCTCGCAAGGACGTCCTGGACAACGAACGAAGCGGGAC
GGGCAATCCTATAAAGAATGGGGCATCAGAAAAATCCGAATTCCCGGATAAATCGCAAGGGGCCGAGAGTCATGGCGTGA
TGTCGGCGCCGGGAAAGCAAAGCCTGGCCGATGAGTCGTCCGCGAAAGCATCCGAGACGGAGCTTTCGGTCGGGAAGGAG
GAGTGTAACGAAGATCCAGTTCAAGCTGACGCTGGGACTACTTCGGCGAGTGGTCTTGCAGCAGCACTAACGCGCCCGGC
CACAACCGTTGTGGCCACATCTATTTCTGAGATGGACGATTTTGGCTTGCCTATTCAAAGGACCGAAGCGATACAGTATG
CAACGGATCTCCCAGAGGACAGTTCCAAACCGGCGGAGCAGAGCTCCGAGATGGGAAATATGTACCTACCGAATGCCAAC
ACCAAGGGGGCAAGTTCCGGGGCATCCACCGAGTCACAGAGGAAGCGGTCTTCGCAGGGCAGCACTGAAGATACCAACGG
CAAAGTTGAGAAAAGCCCGACGTTCCCAGAATTGGACACCACGCTTGCCAATCGCTCCAATACCGGCATTGACGATGAAG
ATCTCCGGACACCGATACCGTCCAGAGAGCGAGCTGCCTCCGATGTGTCGGTTGCTTCAATACCAGAATCACAAATCAGT
GCAGATGTGAAGTCACAGAAGCGATACACTAAAGACTTTGCGAAGGAGCATGCCCGTGTGGCAAGCGTGGCCAGTTCTGC
AGACATCCATAATACATTGTCCGAGTTCTCCCACCAACAATTGTCGACGGAAAAAAAGGAAGTGCCATCTGGTGATGACG
GCGGTTGGCAGACGATGCCGGCATTCGCGCCGTACGACATCTACGACGACGACAACCGCCTCATCGCTCGCGAGCACGTC
GAGACGGAAGAGGATAGTTATGGCTATGCAGGTCTCGGCGGTGCTGGTAAGGGCTATACACGTGTGTTGGTGGACGACGA
CGCCGAATCCGCAACAAGCATGGATGAGAACACACAATATCTATTCCAGCAACCTGGCAGTACAAGCATAACGGAGGATG
AAGAGCAGCAGCGAGATACGGTCTCACAGATGCAAGCCACTAAGAACTTGCTAACGGAGGGACAACGAATTGCGTATGTC
GGTATCACACGTCTACATCTCTCAAATATGGTCAAGGCAGTAGAGAGCATCAAAAAGACAAAGGGATCGCGCAGGACTCT
TCAGAATGCGACCGATTCGATGAGGATGTGGTCGCAAAAGATGATGATCCGGCTGTACGCTCATATGGAGATCAGCATAG
CTGAGCAGGTCATGATTGAGCAGCTGAGCGAACACGGCGTAGAGCCCAAAGACCTGACGTCCGCACTGATGGCCAATTCG
CGTGTCAGTAACCCGATGGCAGGCAACAGAGATAGTATCATCTCCATGTCGTCTTCAAGGGCACCGCAGTCGCCAAAGGC
GCCAATGTCTCCTGGATCTTTCGAAGAGGAAGCTGCCGAGCCGCCTCCGCCATATGAGGAGCATACGGGCGAGGAACTTC
CAGCTGTTCGTACACCATCTCAGATGCCAACGACGGCCAAGATCGACATCGACCTGCGGTGGACTATTCTTTGCGATCTT
TTCCTCGTACTCATCGCCGACTCTGCATACGACGCACGATCGCGAGTCCTCCTCGAGATTGTGGGGAAGAGCCTGGATGT
GCCCTGGATTGACATCTGCAAGTTCGAGCGAAAGGTCACCGAAGCGCTGGAGATGCAGCAGAATGCCGAGACGGAAAATT
GGGACGAGAAAGACCACATGGAGGCACGGCGAAAGAGGGCGCTGAAGCGACGCTACGTAATGATGGGCTTGGCAACTGTT
GGTGGTGGCCTGGTCATCGGCCTCTCGGCAGGTCTGTTGGCACCTGTAATTGGTGCCGGCCTAGCTGCTGGTTTTACCAC
CATCGGTGTGACCGGAACGGGCAGCTTCTTGGCCGGAGCGGGCGGAGCGGCTATCATCACGTCATCTGCTGCGGCATCAG
GCAGTGTTATTGGTGGTCGCGCTGCCGAACGGCGAACGGGTGCGGTGAAGACATTTGAATACCGGCCACTGCACAACAAC
AAGCGAGTCAACCTCATCGTGACGGTGTCTGGCTGGATGACTGGAAAGGTCGACGACGTGCGGCTTCCCTACAGCACCGT
CGATCCGGTCATGGGGGATATCTACTCTGTTTTGTGGGAGCCAGAGATGCTGACAAGCATGGGTGACACAATCAATATTT
TGGCGACAGAGGTAAGGGACAAGGATGTCTAGGCAAGACTGAAGGCTGTGCTAACGTCTTCCTGCCTTAGGCACTCACGC
AAGGTCTACAACAAGTGCTAGGCAGCACGATTCTTGTGTCACTGATGGCAGCACTGCAGCTGCCGGTGGTTCTGACAAAG
TTGGCGTATCTCATCGACAACCCGTGGGCAGTCTCCCTCGACCGAGCCACGATGGCAGGATTGATCCTGGCGGATTCGCT
TATTGACCACAGTCTCGGCACGCGGCCCATCACACTTGTGGGATACTCGCTGGGATCACGGGTGATTTACTCCTGTCTGT
TGGAGCTGGCCCGCAAGGGTGCCTATGGGCTGGTCCAGAACGTCTTCCTTTTCGGGTCTCCCATCGTGGTGAAGAGGGAC
GAGTATCTGCGAGCACGCACCGTGGTTGCGGGGCGTTTTGTGAACGGATACAACCGGAATGACTGGATTCTTGGCTACCT
GTTCCGTCTGACCAACGGCGGAATTCGACGCGTGGCAGGTCTGGGGCCAATCGACGATGTTCCGGGGATGGAGAACATGG
ACGTGACGGAGTTTGTTGTCGGTCATATGGACTACCGGACCGCCATGCCTCGGCTCCTGCGTGAATGCGGCTGGCTTGTG
GAGAGCGACGAGTTTCACGAGATCGAAGACCCGGACCCGGACAACCATGCGCAGCGGCAGCGCGAGCTGATCAACGAAAT
CGAGGAAGCACGCAAAGAAATAGAAAAGGAGAGCAAAACGAAGAAGAGCGGTGCATTCAGCTTTTTCAGCCGCAGGAAGA
AGGGCGAAAAGCAAGAATGGGAGATATACGAAGAGGCCGCAGCGGCCAGGCGAGCCAAAAACATGAAGCCACAAGACGCG
GAGGGGAGCGAAAGCAGAGTTCTGTTTGATGTGGATGCCATCCGAGCTGAGCTGGCCAAGGAAGGGAGTATGAAGGAGGC
AGATCTGCAATTCGATCAGCTGCAAGTGCGAGAGCTAAAGTCGACGCTGCCGCCAATGAAGCTAGACGTGGCCTCGACAG
CAGGACCGGATTTGCCGCTTCCAGCGCCAGCAACGGCGAGATCATCGCTGCGGTCGTCGTTCAGATCGCCGGGAAGGTCG
CCAGGAAGGTCGCCAGGAAGATCACCGAGCGGCAGTCTCGCGGATCTGGACACTGGCGAAGCCGCAACGCCGTTTCAGCT
CTCGCACGAGCACCGGTCATATTCGGCGTCATTTGACAGCCACCAGCTGTCGGATGAGCGGACACGACCATTGCGAACGC
GAGTGTCTTGGGCACAGCCATATACCAGCAACATGGTGGCAGAAGAGGATGGCATATCCATGGTGTTTGACAGTTCGTTT
GACGACGGGCCGTCGGGGGCGGAAGACCACACCATGTCGTCGGCGACACCGTACGCTTCTACCAGTGTTACTCATACGGA
CGAGTCGGAAGCCTCGATGGACACAAGGTCTCGGCCGACGTCAACGGTACCGGCCATCAAGCTGTCCGATCCGTGGGGCG
ATGACGATGACGACGATCTAGGGAGGGAACAGGAAATATCAATGACATTTGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62