GenePrediction:GLEAN_1564 Details

Name: GLEAN_1564
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:667737..668505 (+ strand)
Length: 769
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:667737..667827 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_82:667892..667937 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_82:667999..668285 (+ strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_82:668354..668505 (+ strand)
Length: 152
>GLEAN_1564 class=GenePrediction position=GCSC_82:667737..668505 (+ strand)
ATGGACGCTCAGCAGGTGCCGCCAGGCTCGCTGAGCTGGCGCCTCAGCACACATCCCATCACGCTGCTCACCTATCTGGG
CATCCGCATCGGTGCGTCAATCAAGACCAATCGTCGACCGCTGACAGCTGCATATGCTGACATGCTTCTCTACAGGCAGC
TTGCTCGTCTACCTCTTCGGCCTTCTCTTTACGGCCAACAAGTATGACCTCGTCCGGTTGCCGGTTTGGTTATACTCCCC
CCCTCTGACAGTGCATCCCTAGGGTTCTCGTCTTCATCATCACCATTCTCCTGTTGGCTGCCGACTTCTACTACCTCAAG
AACATTGCCGGCCGCCGTCTCGTCGGCCTTCGCTGGTGGAATGAGGTTGACCCGCAGTCTGGCGACAGCCACTGGGTCTT
TGAGAGCAGCGACCCGGCATCTGGCCGCGTCAACAACGCCACCGACAGCCGCTTCTTCTGGCTAGCCCTCTATGTTCAGC
CGCTGTCGTGGTCCGGCCTCTGCATCCTCGCCATCTTCCGGTTTAACATACTGTGGCTGCCGCTGCTTGGTAAGCCGACT
TTCTTCTCTTTTTGCTTCTCCTCCCACTGCTCTCTCGCTCGTGCTGACAGTCGGCAGCCATCGCCCTCGCCTTGACCATC
ACCAACGCCCTCGCCTTTTCCCGCTGCGACAAGTTCGGCCAGGCTTCCAACATGGCTGGCTCAGCCTTCTCCACCAACAT
TGCCAGCAGCATCGCCACCGGCGTCTTCGGACGCTTCATCGGCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62