GenePrediction:GLEAN_1565 Details

Name: GLEAN_1565
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:677364..678355 (+ strand)
Length: 992
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:677364..677470 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_82:677659..677704 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_82:677840..678355 (+ strand)
Length: 516
>GLEAN_1565 class=GenePrediction position=GCSC_82:677364..678355 (+ strand)
ATGTCGGCCCTTGAACCTCCACCGACCAACGTCCCCAGCACTGCTACTGTGTTGGCTGTGGCTCCAACCGTGACTGGAAC
GAGCGAATTCTGGATATTTGGCTATGGGTGAGGCGCACCGTTTCAGCTTGTTCAGCCTTGACGGCTGTGTTGTTCTAGAC
TAACTTCCTCTGTAGAAGCCTGATCTGGAAACCACCCCCTCATTTCGGTAACGATCTGTCTTTTGGGCGTATATTTTAGA
TAAGACCCGTCACTGCGAGCTCTCTTGCTGATGTAGATGGCTTCTTGACAGACAGGAGAATTCCAGGATGGGTCAACGGC
TACGTCCGAAGATTCTGGCAGGTAAGAGAACCAGATTCCCTTTTTTTGTGTCTTCAGCAAGTCTGACCTTTATGATAGGC
CAGGTGAGCACTTTGCAAATATTTGCTTATATGGGGCTCGTCTCCAGCAAATGACCAGTAGCATATCATCTGACAGAAGG
TGGCCACGTGCAGTGAAGACCATCGGGGAACGCCTGAAGCCCCTGGCCGTGTTGTTACCCTGATCGAGCGGTCTTTCTGG
GAGAGCCTCACCGACCACCACGCATCGGCCTCAGAGAAAACATGGGGAGTAGCTTATCGGATAGCTGCCGAACATGCCGC
AGAGGTCCGAGAGTATCTCGACATCCGCGAGATCAACGGGTACACCATTCACTACACGCCCTTTTACCCCGCGGACAAGT
CGCCTGCCTTCACCACGATGGTATATATCGGTACACCGGACAACGCCCAGTTCACCGGTCCTCAGGACGTCCAGTCACTC
GCCGAGCACATATCTCGATCCTCCGGTCCAAGCGGTCCAAACATAGACTATCTTTGGGGCTTGGAGTCAGCCCTGGACGA
GCTAAGCCCCGAGAGTGGGGATGAGCACATCACAGACTTGTCAAACCGGGCTCGGGCAATTAACGAGCAGTTTGCAGCAG
CAGATCGCTGCCAAGGAAGTCGGCACAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62