GenePrediction:GLEAN_1566 Details

Name: GLEAN_1566
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:689225..690980 (+ strand)
Length: 1756
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:689225..689499 (+ strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_82:689552..690980 (+ strand)
Length: 1429
>GLEAN_1566 class=GenePrediction position=GCSC_82:689225..690980 (+ strand)
ATGTCTTCGGCAATGATAACGACGACCGCGTGGGTCCCGCGTGGATTTTCCGCCCCCTTTCCGCAGAAATACGACTTCAA
TGACGAGGAGTTCGAGCGGATAGCTAAGCTAGCAAGGCTTCAACTCGACGATGCTCAAGAAGATCTCGACGAGGCAGAGG
AGGAGGGCAATGATACGGCCGGAGAATCCGGTGCACAGAAAGGCGGCGCTGCAGAAGAAAAGGGAGACAAAAAGAAAAAG
GGAAAGAAAATCAAGAAAGAGTATGTTGAGCATGGGTCTGCTCAGGCACGTTTGATAGGGAGGATATTGGCTAACGGGCT
GACGCAGGATCGACATCAATGATGACGATCTAAAGGAGTATGACCTGGAGCATTACGACGACGACGACGGTGAAAATGGT
GGTCTTGAGGATGTGGCGAGCCAACCAATGTCGATATTTGGAAACATCAAGTCGCTTGCGTATTACGAGTCCAATAAGGA
TGATCCATATATTACTTTGAACGACGTCGATGCGGAAGACGAGGAAGACGACCGACAGGACCTGCAGGTTCTGGAAACCG
ACAACCTCGTGCTTGCGGCCAAGGTCGAGGACGACCTGGCGCACCTGGAAGTGTACGTGTACGAGGACGGGGCAGACAAT
CTTTACGTGCATCACGACATCATGCTGCCGGCCATTCCTCTGTGCGTGGAGTGGCTTGATCTGGCGGTCGGCAAGCCGGG
TGTCGGGGCGGACAAGGCGGCCAACTTTGTGGCAATCGGGTCGATGGACCCGGACATTGAGATCTGGGATCTCGACACGG
TGGACTGCATGTACCCCAATGCCATTCTCGGGCAGCGGGTGGCCGGAGACAGCGGGGAGAAGAAGAAGAAGAAGAAGGCC
AAGAAGGCCAAGAAGGCCAACGACGAGTACCACGTGGACGCGGTGCTGTCGTTGGCGGCGAACCGCAAGCATCGCAACCT
GCTGGCGTCGGCGTCGGCCGACAAGACGGTCAAGCTCTGGGATCTCAACACGCTGGCGTGTGCCAAGTCATACACGTACC
ACACGGACAAGGTGTGTTCGCTGGCCTGGCACGCGGTAGAGTCGACGGTGCTGCTGAGCGGCAGCTACGACCGCACGGTG
GTGGCGGCAGATATGCGGGCACCGGAGGCGACGCGGCCACGATGGGGTGTTGAGAGCGACGTGGAGAACGTGCGGTGGGA
TCCGCACGACCCCAACTTTTTCTTCGTGTCGACGGAGAACGGCATGGTGCACTACCACGACGTGCGCATGGCGCCGGCCG
ACCCGGTGGCCACCAAGGCCGTGTGGACGCTGCAGGCACACGACGAATCGGTGTCCTCATTCGACATCAACACGGTGATT
CCCGGCTTCATGGCCACCGGCTCGGGCGACCGCACGGTCAAGCTGTGGAACATCCAGGCCTCGGGACCGACGATGGTGGT
GTCGCGCAACCTCGACGTCGGTAAGGTGTTCTCGTCCAACTTTGCTCCAGACCCGGAGGTGGCCTTCCGTCTGTCGGTGG
CCGGCAGCAAGGGCACGCTGACGGTGTGGGATACCAGCACCAACGCGGCCGTGCGCCGGGCGTTCGCCACCAAGGTGCCA
GCCCTGGCTGACGCAGACATGGTGGAGGACCGGATCGTGGGTGTCGAGGACGACGAGAGCAGCGAGAGCTCGGACGGGGA
GGACGACGAGGAGGAGGGCGAGGATGGTGGTGTTGCGGTTGACGATGACGGAGATGAGTCCATGGCTGAGGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62