GenePrediction:GLEAN_1568 Details

Name: GLEAN_1568
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:697695..699867 (+ strand)
Length: 2173
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:697695..697908 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_82:697973..699867 (+ strand)
Length: 1895
>GLEAN_1568 class=GenePrediction position=GCSC_82:697695..699867 (+ strand)
ATGTCGTTTCCGACTGGCTCTTCAATTCGATCATGGCTGCTTCTGGCGCTGCTAGGCAGCGATGTCATCGGCAGCCCGGT
GGCGCGTGATGCTTCGCGGTTCCGGCAGCAGAGTGACGGGCCCCAGCACGTTCTGGGCGCAGCAGTGTCCGAGACGGCGG
CGACGGTAGCACCGGCCTCTCGACGACTCAACGGCAAGTTTCTCCACATCACCGGTCAGTACCCCATCGTGTCTCCTTTT
CACCTTACATTGTTGGCTCCCTGTCCTTCTGACCGAAGACCGTCCGGTGGCAGACTTCCATCCCGACGAGTTCTACAAGG
TGCATTCGTCGACAGCCGAGACGTCGGCCTGCCACCGCGGCAAAGGCGTGGCCGGGACGTATGGGGCGGAGACGTCGGAC
TGCGACGCGCCATACTCGCTCATCAATGCGACGTTTGACTGGATCGCCCAGCACGTGCGCGACGACATTGACTTTGTGAT
CTGGACGGGCGACAGCGCGCGGCATGACAGCGACGAGCGGCTCCCGCGGTCGGCAGCACAGGTGGCAGGGTCCAACCGAT
TCCTGGCCGACAAATTTGTCAGCCTGCTCGACGACCCCAAGGGCCGGGGCTTGGCTGTGCCGGTGGTGCCGACGCTGGGC
AACAACGACATCCTTCCGCACAACGTGCTCTCGCCGGGGCCGAACAAGTGGCTGAAGCAATACGCGGAGATCTGGCAGCG
GTTTATCCCGGAGGAGCAGCGCCACGCGTTTGAGTTTGGCGGGTGGTTCTACGTGGAGGTGATTCCGAACCAGCTGGCCG
TGTTCAGCCTCAACACGCTCTACTTTTTCGACCGCAACGCGGCGGTGGACGACTGCGTCAGCCCTTCGGAGCCCGGGTAC
AAGCAGCTCGAGTGGCTGCGGGTGCAGCTGCAGTTTCTTCGTGAGCGCGGCGTCAAGGCGATCCTGATGGGTCACGTGCC
GCCTGCACGCACGGGCAGCAAGCAGCTGTGGGATGAGACGTGCTGGCAGAAGTATACGTTGTGGCTGCGGCAGTATCGCG
ACGTCGTTGTCGGCTCGTTTTACGGACACATGAACATCGACCACTTTATGGTGCAGGACACTGACGAGATCAACTACGAC
CTCCTCGGTGTCGTGGACGAGGAGGACGAGGAGGATGGAGACAAGGACGAGGGCGTGGACGGTGGCGGTGGTGACGGAGT
AGTGGAGGAGGCCGAGCAGCCGGGCTCGGTGCGCGCGACGATGGAGGACGAGATGTTGACGAGATCGGCGGTGGACTATC
TGCAGGAGCTGCGCAACGGCTGGTCGAAGCTGCCAAACCCATCTTCGCTGGGAGAGGCGGATGCCGACAAGAAGAAGGGG
CGGAAGGGCAGAGGGCCGGAGCTGTCGCGCAAGTGGAATGAGCGGTACCAGGTGACGCTTGTGAGCCCCAGCATGGTGCC
CAGCTACCTACCGACGCTGCGGATCGTCGAGTACAATATCAGTGGGCTCGAGGATGTGCCCGTGTGGACCGAAGGGGCGG
GTCACGTGCCCGTGCTTCCGGACGACGGCAAGCTCTATGAGGCGGAGGGCAAGAAGGGAAAGAAGGGCAAGAAGGGGCGC
AAGGGAAGGAAGGGGCGCAAGGGAAGGAAGGACCGGGACAGGGATGGGAAGAAAGACCCGAATCTGACGGTGCCCAAGGG
GCCAGCCAAGACGGCGGCGATCGGGCCGGCGTACTCGGTGCAGCCGCTGTCGCTGCTCGGCTACACGCAGTACTATGCGA
ACCTGACGCAGATCAACAACGACATTGTGGCGGCAGCTCGGCAGGCGGACGAGACGGTTGAAGCTAGCCGATGGCGCAAG
GGCAAGCACAGCGACAAGGATCCGCGGACGAAGCCGGCGAAACCGCACAAGTTCAAGTTCGAGGTGGAGTACAGCACCTT
TATGGACAAGGTGTACGGGCTTTCAGACCTGACGGTGGGCAGCTTCATCGAGACGGCCTACCGGATAGGCGGCAAGGCGG
GAAGAAAGGCGGGCGAGAAGACGGATGAGAAGGTGGATGACAAAGCCGATGACAAAGCCGAAGAGGTCGAGCAGCAAGGC
AAGAAGGCGCAGAACAAGGTCTGGCTCCGGTTCCTGCGCCACGCGTTCGTGACCACGGTGGAGCGCGACGAGCTGGAGAG
GCTGGGGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62