GenePrediction:GLEAN_156 Details

Name: GLEAN_156
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1066057..1067445 (+ strand)
Length: 1389
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1066057..1066394 (+ strand)
Length: 338
Type: CDS
Source: GLEAN
Position: GCSC_179:1066471..1066587 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_179:1066716..1066849 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_179:1066917..1067041 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_179:1067119..1067445 (+ strand)
Length: 327
>GLEAN_156 class=GenePrediction position=GCSC_179:1066057..1067445 (+ strand)
ATGAAGGACTTCCTTACCGTGACTTCTGCAGTCATCTGCTTCTTTACCTTCGTCCCACTTGTCATCGGTCTCCTCCTCTC
TGACCTGGTCTGCTTCACTGTCAAGAAGACAGTTGGTCACATCTACCCGATCATCGATGGACATCTGGCCGGGAGATTCC
TGAGCTACGATGTGGCTAAGATGATGATCTCGTTGCTGGTCCGATTTGTCATCTTCATCTCGAGTGATGGCACTTCCAAG
AACCAAGCCAGCACCTCCCACCCCGGAGACATCAAAGCCACACCTGCCATCGTTGAGTTGAACTCGGCTGAGCCTGCTGA
TACGCAGACCACAGGCAAGTAGCAAATCCTTCATCCCAGACACCCCACACCAGAAGTACTACTACTGACCGCTGGCAGTT
GGGACAGATGACAGCACCGAAATATACGGTGTCGTGGAGCTTTCTGCATCAGAGGTGCAGGAGCCGAAGACAGCCCACAA
GAATGTGGAGTCTGTGATTGTGAACGTCGACATTTCTGAACTTCTGAGTCAGTTCGACGAGTCCTTCTAGAGCAAGGACT
CGTCTTTCTTGACCGGGGTGTCATCGTGAGTTACTCATCAACTGCCCCTCACACCAATGACAAACAAAAACCAACGGTCA
CTGACACAATAATAAACAGGACTATCAAAGAGTTCCTGTCTCTTGATGGCTTTGTCAACTCCATCTACCAGACCGGGGTC
GACGAAGATGCTATGTCTGCTACTTCCAAGGACAGTGACTCTGATTCTGAATCCTTCCACTCCTTCACTACAGGTATGTT
TCCGATCATCTTCCACCTTTGTTGACAAGCTATTAATCCTAATATATCGAACCACTGCAGACTCTGATGACGAGTCTGAT
TCCACTGAAGAGAGCATCGCTAGCCAGGTCTTCAAAGAAGAACTAGCAGCAACGACGAGCATTTCCAACATAGGCATTGC
CGTCACAACCTCCATCACTGCCACCGTCCCCGAATGCCCCACTACCTCAATTCACACACCCTCTGTCATCGAGAACCCCC
TCCCCCCTCCTCTACCACCCAGTCCTCTGTCGACTGCAGCTTTGAGTTGCCCCCTACGATCTCGTGCGAGGAAAACTTGG
CTGATGCAGCTGAAAGCATTCACCTGCGGACTGTGGACTTCCTCGATGACGTGGATGAGGCATGGCGAGTTTGGGACCGA
TACAACGAGATTTCATTGCCCAAATGCAGATGGATTTTGCTAGACATCCCGGACGTTTTCGGTGACTGCCGCGGGCCAGT
CTTGAAGCTGACAACGCCTGAAGGGAAAGTCAAGTATCCTCAGGACATGCGCATCTACGATGCCGTTCGCAGCTGGGCTG
ACGAAGACGTCGACGAAGATGGCTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62