GenePrediction:GLEAN_1570 Details

Name: GLEAN_1570
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:714450..717350 (+ strand)
Length: 2901
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:714450..714761 (+ strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_82:714882..715901 (+ strand)
Length: 1020
Type: CDS
Source: GLEAN
Position: GCSC_82:716148..716867 (+ strand)
Length: 720
Type: CDS
Source: GLEAN
Position: GCSC_82:716970..717018 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_82:717067..717350 (+ strand)
Length: 284
>GLEAN_1570 class=GenePrediction position=GCSC_82:714450..717350 (+ strand)
ATGACGATGCCAGGGCCAGACAGTTTGACGGCAGCAGGAACGACGCCGACGCCGTCGGTGTTCAGTTTCGATGCGCTCTT
TGACAACCCCATGTTTGCGGGTGGCATGGGGCTGGCCGGGCTGGGAGCAGCAGCAGCGTTGGGGCGGCGCGGAATGATGC
AGGGAGCCGAGCTGCTACGACGACGGCTGCTGGTGAACGTGGAGATCAGCCGGCGGGACCCGTCGTACCCGTGGGTGCTG
GCATGGCTTTCGGAGCCGCGGTCAGCAGGCGGCTTTGTGGCCTCGCGGCTGACACGAATCCACAACCTGTCGGTAGCGAC
AGCAACGAAGAAGACAGCCGGAGAAGGAGGCGGAGCAGGAGAAGGAGCAGGAGACGGAGCAGGCCAGGCACAGATTGTGT
TGCAGCCCGGATACGGACGACATGTGATCCAGCACCGGCCAGGAGTGTTTATCGGAGTGCGGCGCGAAAAACAGAGCACG
TCCAACATGGCGACAGGCGAGCCACACGAGACCGTGACGCTGACGGCATTATGGGCCCAGCGACACGTGTTCGAAGAAGT
GTTTGCGCAGGCGCACGCGCTAGCAGCACGAGCAGCCGAGGGCCGGACGCCCGTGTTCAGCGTGCAGGGCATGGGATGGG
CGCCGCTGGGCGAGCCGCGAACGAAGCGGCCGCTGGCATCGGTGGTGCTGGACAGCGGTGTGGCCGAGGGCGTCGTGGCG
GACGTGCGAGACTTTCTGGCACGTCAGCAGTGGTATGTCGACCGTGGGATTCCGTACCGCCGTGGCTACCTGCTCTACGG
GCCGCCGGGCAGCGGCAAGACGTCGTTTATCCAGGCCCTGGCAGGCGAGCTGGACCTTGGCCTCGCTGTCGTCAACCTGA
GCGAGACAGGCATGACGGACGATAAGCTGGCCATGCTGCTGATGCGGCTGCCACGGCGCTGTGTCGTGCTGCTGGAGGAT
GCCGACGCTGCCTTTGTCAACCGGCGAGCCCGCGATCCTGACGGCTACGGCGGCGCCACCGTGACCTTTTCTGGCCTGCT
CAACGCGCTCGACGGCGTCGCGGCTGGCGAGGAGCGCATCGCCTTTCTGACCACCAACCATATCGACCGCCTTGATCCAG
CCCTCATTCGTCCCGGTCGCGTCGACATGATGGTGCGCATCGGCGAGGCCACTGCCTTCCAGGCTGCTCGCATGTGGGAC
CGTTTCTACGGTGATGTCGACGTTGACGGTGCAGGCCGCACTCGCTTCCTGCAACGGCTATGCAGCCTCGGTCTCGTGGC
TGATCCAGATGCCGTCGACCGTAGCAGCTCGGTGCCCCGACGACACACCAGCACGGCTGCTATTCAAGGTCTCTTCCTCT
TCAACAAGACCGACATGGAGGGCGCCATCAACATGGCCGAGGGCCTCATCCCGCGGCACTTTGAGCCTGAGCCCGAGGAC
CCGAGCGGTACGGTAAAGTCACCGGCTTGAGGACTACGACGTCCTGTTCTGTAGTAGTTGTGGCATAGACCAAATGGATA
CCCAGACTAGCCGCCAGCGAAGAATATGCAATATGCAATAATCCGAGCATCCAAACCACCTATCGATAAGCTTGACCGCC
AAAAAAACCAGAGCAACGGCAGAATGCGTCTTAGTCTGGAAAAAAAATCTACATACTGCACGACGACCTCAAGGAGGACC
ACGTCTCACCACCACCAGCACCACCACCCCTTCACCTCACAATCGACCATGCTGCGCCAGATCACCCCCCGCAACGCGCG
GTCCAAGCGGGCGCTCGACAAGCGGGCGCCCAAGGCGGACGAGAACCCCAAGACCTGTCTCTTTCTGCGCGGCACGTCGG
CATCGCAGGTCGTGCAGGACTGCCTGACGGATCTGCACGCCATGCGGGCGCCGCTGGCCAAGAAGTTTACCAAGAAGAAC
ACGGTGCACCCGTTTGAGGACCCGTCCAGCCTCGAGTTCTTCTCGCGCAAGAACGACACAAGCCTGCAGCTGTTTGGCAG
CAGCAGCAAGAAGCGCCGCCACTGTCTGACGCTGTGCCGCACTTTTGACCACGCCATGCTGGACATGCTGGAGCTGTACG
TCGATGAGACTACGTACCGGCGTCCGGGCCAGGCGGCTGAGCCGGCCAGCACCACCAGCACCGATAGCCCGGTTCCCAAC
CCCCGGCGCTCCATTCCTGTCGGCGCCCGTCCGATGGTCCTCTTTGCCGGCTCGCCTTTCTATGAGGCCGACGTCGAGCA
CGGAGCCACGCCGCTGACTGAGTCTGGCCGCAAGTACGCCCTCGCCAAGAGCTTGCTCACCGACTTCTTCCGCGTCGACA
GCTCGCCCGACAAGATCGACGTCGAGGGCCTCTCGCACATTGTCGTGCTGACCGCCGAGGAGGACTCTGCCGATGATGTC
GCCGCCACCGGAGCCCCTGTCAAGAATGCCGCTGCAGCAGCTGCTGCTGCTGCTCTCGCTGCTCCTGCTGCTGATGCTGC
TGCCAATCCTGTCCTGCACATGCGCGTCTATGCCCTCCAGACAAAGCGCAGCGGTCAGCGTCTGCCTCGCATTGAGGTCG
AGGAGATTGGTACGTCATCTGTCTTCCTCTTCTTTTTCCTTCCTCACTGACTTCCAGGCCCTCGCATGGACTTCCGCCTC
GGCCGCTTCAAAGAGCCCGACAGTGCCATGCTCAAGGAGGCCATGCGCCGCCCCAAGACCAACGAGCCTCGCACCAAGAA
GAACATTGAGACCGACGGCATGGGCGACAAGATCGGCCGCGTCCATCTGGCCAAGCAGGACATGGCCGAGCTGCAGACCC
GCAAGATGAAGGGTCTCAAGCGCCTCCGCGGCGACGCCCTCGATGACGGCGCCTCTGTCGCTGACCCGCAAGAGGACGCC
CCCAAGAAGGCAAAGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62