GenePrediction:GLEAN_1571 Details

Name: GLEAN_1571
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:720920..722293 (+ strand)
Length: 1374
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:720920..721249 (+ strand)
Length: 330
Type: CDS
Source: GLEAN
Position: GCSC_82:721427..722293 (+ strand)
Length: 867
>GLEAN_1571 class=GenePrediction position=GCSC_82:720920..722293 (+ strand)
ATGACGGAAACCAAGATGGCCGAGCCGAATGGTGTCGCAAAGCCGACAACGACGGCCTCCTCGACAGGCCTGGTCAAGCC
TGCGGTAGCCGGGTTTGGCACGCTGGCCGTGCATGCCGGCTCGCCGCACGATGCCGTGACGGGAGCCGTGATCGAGGCCA
TCAGCCTGTCGACGACGTTTGCGCAGTCGGCCGTCGGCCAACCAGTCGGCGCTTTCGAGTACAGCCGCAGCAGCAACCCG
AATCGAGCCAACTTTGAGCAGGCCGTGGCTGCGCTGGAGCACGCCCGCCACGCCCTGGCCTTCTCGTCCGGCAGCGCCGC
CACGGCGACCGTTTTGCAGGCTTTGGCTACGACCATCAGCGAAGACGCTCCCGGATCTTCGTCCTCGTCCTCTTCGTCTT
CGTCTTCAACTTCGCCTCCCCCCATCTCCTCCTCCTCGCCTGCTCACGTCATTTCCGTCTCGGACGTCTACGGCGGCACC
CATCGCTACTTCACCCAAGTCGCCAAGGCCCACAACATCCGCGTCACCTTCACGCCCGCCATCGAGGTCGACATCGTCAG
CCACATCACCCCGGCCACACGCCTCGTCTGGATCGAGACCCCGTCCAATCCGACCCTGCGCCTCGTCGATATCGATGCCG
TTTCCCGTGCCGCTCATGCCCGTGGCGTCCTCGTCGTCGTCGACAATACCTTCCTCAGCCCCTACATCCAGAACCCGCTC
GATCATGGCGCCGACATCGTCGTTCATAGCGTCACAAAGTACATCAACGGCCACAGCGACGTCGTCATGGGTGTCGCTGC
CTGCAACCGCGACGATCTGCATGCTCGACTCGCCTTTCTGCAGAATGCCGGCGGCGCCGTTCCCTCGGCCTTTGATAGCT
GGCTGGCCCATCGCGGCCTCAAGACTCTGCATCTGCGTGCCCGTGCCGCTTCGACCAATGCCCTCCAGCTCGCTACTGCT
CTCGAAGGCCGTCCTGACCTCGTGAGCGCTGTCCACTACCCCGGCCTCGACTCTCACCCCCAGCGTCCTATTGCTCTGCG
TCAGCACCGCGACGGTCTTGGCGGCGGCATGCTCTCCTTCCGTCTGAGAGCCGGTCACGCTGCCGCTGAGCGCTTTTGCC
AGAATACCCGCCTCTTCACCCTCGCCGAGTCGCTTGGCGGCATCGAGTCCCTTGTCGAGGTCCCCAGCAGCATGACCCAT
GCCGGCATTCCCCGCGACCAGCGCGAGGCCGTTGGCGTCTTTGACGATCTCGTCCGCGTCAGCTGCGGCATCGAAGACTC
TGCCGATCTGCTGTACGATGCTCTGCAGGCCCTTGAGCGTGCTTCTGTCGAGCCTGAAGCCCTCAACGGCAATGGCAGTG
CTGTAGCCCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62