GenePrediction:GLEAN_1572 Details

Name: GLEAN_1572
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:738409..739269 (+ strand)
Length: 861
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:738409..738889 (+ strand)
Length: 481
Type: CDS
Source: GLEAN
Position: GCSC_82:738965..739269 (+ strand)
Length: 305
>GLEAN_1572 class=GenePrediction position=GCSC_82:738409..739269 (+ strand)
ATGGCAAGGCGAATTAAGCTTTTATTCCTTGGCGTGATGGCCTTTACCATCTCCATCCTGCTTTACTCGTCCCGTCTGCG
CCAGTCACACACCCCCGACCAGCGGACGATACAGGACTTCTACCACAAGACGAAGTCGGCGCTGGATAAGCTGTCCCCGT
TAGACACACTTGGCACAAGCGTCAATGGCGAGAAGGGCGCTCCTGTCGTCGTTGACATGGACGCCGATGGTGATATTGAC
GAGGACGATGTGCGCTTGGCCCGCGAGATGGCCGACCGGCTTCGAGCGGCCGAGCAGCAGGCCAAGGACCTGGCCAACGC
CAAGTCACCGAACAAGCCGGACCTGCCCAGCAACTTGGTAGGCGTGGGCAGCTCAGCCAGCGGACAGAAGCAGGAGGTTG
CCGAGAGCTCCGAGGGCACCGAGTCAGAGACGGAACATGCGGCAGAGGAGGAGCTTGACATCATTATCAAGAAGGCGCCG
GGTAAGTAGCGAAGGGCTCAGATACAATTTTACGAGGATGACAAGCAAGCGCGCACGCTGCTAACAGTTTGCCCAGTTAT
CATTTTCTCCAAGACTTACTGCCCGTATTCGAAACGCGCCAAGGGCCTGCTGCTCGACAAGTACTCCATCGATCCGGCGC
CATTTGTCGTCGAGCTCGACATTCACCCTCTGGGTGCGGCACTGCAAGCACGGCTAGGCAAACTGACTGGCCGGCGCACC
GTTCCCAACATCCTTGTCGGTGGCAAGAGCATCGGCGGTGGCGACGACATTGCCGAGCTAGACCGTAAGAAGGCGCTAGT
GGACAGGGTCAAGTCATTGGCTGGCAACGGTCTAGAGATGAAAGAACGGCTGTCGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62