GenePrediction:GLEAN_1574 Details

Name: GLEAN_1574
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:741879..742682 (+ strand)
Length: 804
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:741879..741893 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_82:742049..742125 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_82:742233..742529 (+ strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_82:742613..742682 (+ strand)
Length: 70
>GLEAN_1574 class=GenePrediction position=GCSC_82:741879..742682 (+ strand)
ATGGCTGACGAATACGTACGTGAATACCTGTGCCATTCTCTCGTCGACACAAATCCAATCCCGGCGGCCGCAGGAGGGTG
TCTTCGGGCGACCACCCCTCGATGGCAACGATACCGGTGGTGACGAGGACAGAGAAGCGAGGCTGGGCTAACATCGTGTC
TTTACTCCAGAACGCCGAGGAGGCTGCCGAGCTTAAGCGCAAGAGAGCGTTCCGCAAGTTCTCCTTCCGGGGTGTTGACC
TCGACCAGTATGTCGCCCATCTAGCGCGTCGTTTCGGCATCATGGCGCTTCGCACCGTTTCGGCTACCCATCAACGAGAT
GCAAGATTGTTCTAACACCAATTTCTTTCTGTAGGCTCCTCGATCTCGGCTCTGACGAGCTGCGCGATGTTGTGCACGCC
CGCGCACGGCGCAGGATCAACCGGGGTCTGAAGCGGAAGCCGATGGGCCTGATCAAGAAGCTGCGGAAAGCGAAGCAGGA
GGCCAAGCCGAACGAGAAGCCGGACGTCGTCAAGACGCACCTGCGTGACATGATTGTCGTCCCGGAGATGATTGGCAGCG
TGATCGGCATCTACTCCGGCAAGGAGTTCAACCAGGTCGAGATCAAGCCGGAGATGGTTGGCCACTACCTGGCAGAGTTC
TCTATCTCCTAGTACGTGTCATTCCTCCTGAACACACCCCGGAACTTCATGGTCTTCGGCCATTGTATGCGGAGTTACTA
ACCAACTTTCACAGCCGGCCTGTCAAGCACGGTAGACCCGGTATCGGTGCTACTCACTCTTCTCGTTTCATCCCCCTGAA
GTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62