GenePrediction:GLEAN_1578 Details

Name: GLEAN_1578
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:759079..761334 (+ strand)
Length: 2256
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:759079..759192 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_82:759260..759280 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_82:759357..759405 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_82:759480..759555 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_82:759623..759813 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_82:759876..759910 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_82:759974..760094 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_82:760162..760505 (+ strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_82:760579..760701 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_82:760774..761334 (+ strand)
Length: 561
>GLEAN_1578 class=GenePrediction position=GCSC_82:759079..761334 (+ strand)
ATGACTAAGCAGACGGAAGAGGCCGATCGCGAGCTCGGCGTCCTGAGCGGCGACGCTGGAGGCGATTCGTTGAGCAACAT
GTCGGCCGGCGACATCAAAGATGCACAGGTTTTGGTGCGTATCTGATTTTCATGTACGCAATAGGCAGCGAAAGGGCAGC
ATGGCTAACTGAGATTCGCAGAAAAACCTTGGTTACAAGCCGGTAGGGAACGAAGCTTTTCCAATTGCTTCACGACGAAT
GAAAGGTTGCTAAACAGACATTCGTATTTGGTTGACAGGTCCTGCGCCGGACGTATAACCTTTTTGAAAACTTCTCGACG
ACGTTCGGTTCGTGCCACTCTGGAGATGTCACATTTCAAATTCCGTAGGCAATCCGGACGGCTGACAGAAACGCATGATA
GCGGCCCTGTACTTTGTCGGTGGTGTGCGCACCACCTTTTCGACCGGCATTGCATCCGGCGGAAATCTCGCGTATTGGTG
AGGAGCCCTCCGATCGTGTGTTCCATCCGAAAAACTGGTCCCGAGCTGACAACATACCGGACAGGACGAGCTACCTCGTG
ACGCTCGTGTTCAGCTTCATCACGGCAGCCGTTATTGCCGAGATCTGCTCGTCGCTGCCCCTTGCCGGCTCCATCTATCT
CTGGGCTGCTGAGTCGGGCGGGCCTCGCTTCGGCCGCTTCTTCGGCTTCGTCGTCGCGTGGTGGAGCACCACTGCCTGGA
CGACATTCTGTGCCAGTGAGCAGAGCCGTGTGGGATAGAGCGGTTGTGGAGCAGATGATACTGACCACGGGTCCCAGGCA
ATACCCAGGCTGCTGTTAACTATATGCTCTCCGTAAGTCACTGCCCAGGGCATAGTGAGAATGCAGACAGACCACGCTGA
CACAGTTTCGGCCAGGAAACCGTCGTGTTCAACCTCGACTTCCCATCCGACAGCTCCAGTGTCAAGTTCCGAGCTGTGCA
ATGGATCTGCACCGAGGTCCTTCTCGCACTCGCGTGCATCTGGAACCTCCTTCCTCGTGAGCCCTGGACTCCTCTTTCCC
TGGCAATGTGGCTCTTCTCTTCTGACATGCAGTGGCCTCGTAGCAAAGTACTTCCGGTCGATCTTCTACCTGTCCAGCTT
CTCGGTCCTCCTTGACTTTCTTCTCAACATAATATGGCTTCCCATTGCCACTAAGAACACGTACGGCTTCAACACGGCGC
ACGAAGCCTTTATGACCACCTACAACGGTACCGGCGCACCGGCTGGCTGGAATTGGTGCCTGTCGTATCTTGCCACTGCT
GGCATTTTGCTCGGCTTCGATGCCTCTGGACACGTTGCCGAGGAGACGAAGAATGCGGCCATCACTGCTGCACGCGGCAT
CTTCTGGAGCACCGTCGTCAGTGGCATCGGCGGCTTTGTTGTGGTCATCTTGTTCCTCTTCTGCGTGGTGCGTGAAATGT
CTATTTTCCTGCCTTGTAACAAGGACCGAATTCAGCTGACTCACTCTCCTCTTCTTCCAGCCCCCTGCAGACATCCTCTT
CTCGTTCGGTGGCTCCCAGCCATTTGTTCCGCTGTACGCCGCCATTCTAGGAGATGGTGGTCACATCGTCATGAACGTGC
TCTGCATCGTCGCCCTCTGGTTTGTAAGCAGTCTTACGCCCTTCACCCTTGCCTCGCACACGTAGCCGCTTACTAAGCAT
GTATACGTCTACCAGAACACTGCCATTGCTGTCCTTGCTGCTTCGCGGTTGGTGTTTGCCGTCGCTCGTGACGGTGTGCT
CCCGTACTCCACGTGGGTGTCCAAGGTCGTCAACGGCCAGCCACGCAATGCTGTCATCGTCGTGTGGGTGGTTTCGGCCA
TCATCACATGCACCGTCTTGCCCTCAGCCGTGGCCTTTACCTCGCTCGTCTCCGCCGCCGGAGTGCCATCGGCTGCTGCC
TACGGACTCATTTCCCTAGCCCGTCTGGTCCTGACACCCAGGACCTTCCCAAAGCCGGCTTGGAGCCTAGGCCGTTGGAG
CAAGCCATTCCAATTCGTGTCCGTCTTCTGGAACGGCTGGGTCGTCGCCGTGCTCTATTCTCCGTACGAGTTCCCCGTCA
CGGCACAGACTCTCAACTATGCGCCTGTCATAATGGTCATTGTAACTATATTTGCCATTATTTCGTGGTGGTGGATCCCA
GCATCCGAGTGGCTACCAAGCCAGAGGATCCAGGCGACGTTGGAGGCACCAGACCTCTCAAGTTCGGAGCCAGAAGTAGT
CTTGAAGGCCTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62