GenePrediction:GLEAN_1586 Details

Name: GLEAN_1586
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:813042..813644 (+ strand)
Length: 603
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:813042..813119 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_82:813180..813644 (+ strand)
Length: 465
>GLEAN_1586 class=GenePrediction position=GCSC_82:813042..813644 (+ strand)
ATGTCTGTCACTCTCCACACAAATATAGGAGACCTCAAGATTGAGGTCTTCTGTGAAAGTGTACCCAAAACCGCAGAGGT
ACTTACGTCCCAGTGCATCATGTTTTTCATTTATCATCGCGTTAAACTACCTCCATAGAACTTCCTGGCGCTCTGTGCAT
CGGGCTACTATGACGGCTCTCCCTTTCACCGCCTTGTACCAGGCTTCATGGCTCAGACCGGAATTCCTGGTAACAAAGGC
GATGGAAAAAAGGACAAGGACAAGGGCACTTCTATCTGGGGACATTCTTTCGATGACGAGATTCGCCTACCTGCACTGCG
CCACAATGCTCGTGGTGTCGTATCCATGGCTAACAGAGGCGCTGCACCTGGCGGCGGAGGCACGAATGGGTCACAGTTCT
TTGTGACGTTTGCGCGCGCGGCACATCTAGACGGTGTCAACACGGTTTTTGGCCGGCTGCTAGGAGACGCGTCGTTTGAA
ACACTGGACCGGCTGGAAGCTGTGCCAGTGGATAAGAAATACCGCCCAAAGATGGCGTTGCCAGATGAGGCACCTCCACG
TATCGAGCGGGTGACCATTCATGCCAACCCGCTAGCCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62