GenePrediction:GLEAN_1587 Details

Name: GLEAN_1587
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:820330..822259 (+ strand)
Length: 1930
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:820330..820425 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_82:820483..820567 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_82:820631..820650 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_82:820721..820756 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_82:820829..820990 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_82:821053..821378 (+ strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_82:821467..822259 (+ strand)
Length: 793
>GLEAN_1587 class=GenePrediction position=GCSC_82:820330..822259 (+ strand)
ATGGCGGACCCACGAATGTCGTCGTACTCAGTGCAGCCTCGGATTACCTACAACACCGTGGGAGGTGTCAATGGGCCACT
AGTTATTTTGGACAATGTCAGCTCAATTGCCATTGTATTCGCTTTCTGGTTGGTTGATACTGATATGGCACAGGTCAAAT
CGCCGCGGTTCAACGAAATTGTGAATCTCACTCTTCCCGATGGAACTGAGCGGTCGGGCCAGGTTCTCGAAGCTAGAGGT
TAGTACCAATACCGACCTAGGCATGGCGCTGCTCTGATGCTGATATACTCCTCCAATACAGGGAACCGGGCCATTGTTCA
GGTACGAGCGGCTGGCGAAGCTTCCATTGCAAAATGTTTGTCTGCCCCTGCTAATACAAGTATGTTGATAGGTCTTCGAA
GGTACTTCTGGAATCGATGTCAAGAAGGCAAGACATGCCCCAAACCCTCTTTCAATCTCACCTAGACAATAATCTAACAT
TGAAATTTCTACTGTTCAGACCAAGGTCGAGTTTACCGGCGAGAGCTTCAAGCTTGGTGTCTCTGAGGATATGCTGGGCC
GGATCTTTGATGGCTCTGGCCGGGCCATTGACAAGGGACCCAAGGTTCTTGCCGAGGATTACCTCGATATCAACGGTAGC
CCGATCAACCCCTACTCGCGAGTACGTTTTTCGTGTGTTAAGAGTTGATGGCTGTCACAACAATGCTGACATTGTTTTCA
CAGGTATATCCTGAGGAGATGATTTCGACCGGTATTTCGGCCATCGACACAATGAACTCAATTGCACGAGGCCAAAAAAT
CCCCATCTTCTCAGCATCCGGCTTGCCTCACAACGAGATTGCAGCGCAGATCTGTCGTCAAGCTGGATTGGTACAGCGGG
AGGGAATTACAAATAAGGGCGTACATGACGGACACGAGGAAAACTTCTCTATCGTTTTTGGTGCCATGGGTGTCAACTTG
GAGACAGCTCGTTTTTTCACCCGTGATTTCGAAGAGAACGGTAGCTTGGAGCGAACTACGCTTTTCCTGAACCTCGCAAA
CGACCCAACGTATGTTGATCGCCCTTACCTGGTACTCGTCCTACGACCCGTTCTACGGACCGTTTCATATTATATGGATT
TAGCGCTGACTAAACAGTATCGAGCGTATCATTACGCCGCGTCTGGCTCTTACCACCGCGGAGTACTACGCCTACCAACT
CGAGAAGCATGTCCTTGTCATCTTGACCGATCTCTCTTCTTACTGCGATGCACTGCGTGAAGTGTCAGCAGCACGAGAGG
AGGTGCCGGGCCGTCGTGGTTTCCCCGGTTACATGTACACGGATTTGTCGACCATCTACGAACGGGCCGGGCGTGTGGAG
GGTCGCAATGGGTCTATCACACAGATTCCGATTCTGACAATGCCCAACGATGACATCACCCACCCCATTCCCGACTTGAC
GGGCTACATTACAGAGGGACAGATCTTCGTGGACCGCGGTCTGTACAACCGCGGTATCTACCCGCCTATCAACGTGCTGC
CGTCGCTGTCACGTCTGATGAAGTCAGCTATTGGCGAGGGCATGACCCGGAAAGACCACGGCGATGTGTCCAACCAGCTG
TATGCTAAATACGCCATTGGCCGTGATGCAGCGGCGATGAAGGCCGTGGTAGGCGAGGAGGCACTGTCTGCCGAAGACAA
GCTCTCGTTGGAATTCCTTGACAAATTTGAGCGGACGTTCATTAGCCAGGGCGCATACGAGTCTCGTACGATCTTCGAAT
CTCTGGACCTGGCCTGGAGTCTCCTGCGAATCTACCGCAAGGACATGCTCAACCGGATTCCAACTAAGATAATTAACGAA
TACTACCAAAGAACGGCAGAGCGCAAGGGCAAAGCAAAGGCGCCGGCACAGGACAAACCGGCAGAAGAGGAAAATCTCAT
TGACGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62