GenePrediction:GLEAN_1588 Details

Name: GLEAN_1588
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:823542..824306 (+ strand)
Length: 765
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:823542..823641 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_82:823697..823773 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_82:823862..823909 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_82:823977..824306 (+ strand)
Length: 330
>GLEAN_1588 class=GenePrediction position=GCSC_82:823542..824306 (+ strand)
ATGCGTAACACCATTCTCATTGCCGCCTCGGCAGTTGGCCTGGCTGTAGCCACGACCAACTTCACGATTGACCCGAACTC
TGTCCAGTTGTCTACGCGATGTTCGTTGCTCTCTCCGCCCTGCCTCTCTTCTGTCACAACTAACGGTGTGAACAGCGAGC
TGGTGCGCTGGCCAGGAAAATACCTGCACCACCCTCTGCTCTGACAGCCCAACGGCAAACTCTTGCGACCCGGTAGGTCT
CTCTGCCTCTGTGTTTCATCGACATACCTAGCTAATTCAGTCCCGATAAGACGACGCTTGACTATTCCTGCCTGTGCCAG
AACAAAAGCGCGCCCGGCCTCCAGTACTACCTTCAGACCATGCCTACCGTGAGTACTATCCTGTCGTGACAATTTCCGGG
CCTCCCGGCGCGGACTCTGACAGTTGGCTCTTTAGTACATCTGCAATGAAGCCTACGCCGAATGTGTCAGCGAGAACCCG
AACAACGCCACTGGCCAGTCTGCATGCAAATCGGACATCCAGGACAACTGCGGTACCCTTGACCCCAGCAAAGCAGATCT
GAGCAGCGGAACGACAACTTCGGCCGCTGCTGCTTCTACTACTGCCTCGACCACTGGCTCGAACTCGGCCACCGCTGCTA
CCACTGCCTCTGCCAGCGCTGTGACTACCGCGAGCTCCAAGGCTGGTGCCATGCCCACGAACATGGCACACTATGGTAGC
GGTGTCGCCGCTGTGGCAGTCGGCCTTTTCGCCTACGTCCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62