GenePrediction:GLEAN_1589 Details

Name: GLEAN_1589
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:825737..827852 (+ strand)
Length: 2116
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:825737..827582 (+ strand)
Length: 1846
Type: CDS
Source: GLEAN
Position: GCSC_82:827650..827852 (+ strand)
Length: 203
>GLEAN_1589 class=GenePrediction position=GCSC_82:825737..827852 (+ strand)
ATGACCAAGAAGGACGTGGACAAGGACCCCGAATCAACAACGCCCACCGTTGGCGCCCGAGTGGTGGCATTTCTCAATCC
CTTTAGGGCCACACACAAAGCGGCGGTGACGAGGCAGACACACAACCACAAGCACAGCAAGGGTAGCAAGGGTCACAATG
GCCGGTCCGCACCGTCTCCACGCTCCGGCACGTCGAAAGCGCACGCATCAGCTTCACACACCCGGCTGAAGCTCCTCGAT
CTGGACCGGACTCGAAATGAGCTGGATGTGGAGATTGCTCCCACCACTGTTGCAGCCAGGCTTGAGGCCACCATCCGCAA
CCGCAACAAGAAGCAGCCGCTCGCCGACAGCGATCTGCTTCACATATACTGGCTTTGCAAACCTGGCAATGGAACTAGAG
CGCCCGGACCCCAGCAGCTACGACCCAGCGATGTCGTAAGCGCTGTCTGTCCGCGCGATGCTACTCTCTACTACCGCGTC
ATTGCTGCCGACGACGCCGAACGCGGTCGTGGCCAGCACCTGGAATTCCGCGTCGAGTGGCTTTCACCGTTGTCTGCACC
GTCTGCCTCGAATTCCAATGGTCACCGTGGCAGTTTGAGAGATCGCGAGCGCAAGGGTGACGGCAGGCAGAAGAGGGCAC
CGAGCCCAGACTTTTTGCGAGAGCTTGCCCGGGACATCTTCAGCACCGACCGCCAGCTGGCTGTAGGGGCTGTTCGTTCC
CGGCTGGCTGCGGTACTCGGCGTCGACGATCCTAACCGAATTGCCCTCCTTGCCTACAGTGGCCTGCAGCCGTGCCAACC
GCTGGCCGGCATCGCCTGGCAGGTCGGCCGCCTGCTGACGGCATGGCTGTGTCGCTGCCTGCTGGTTCAGGTACACCCGC
CCAAGCGCTATGTGGTCGTCCGGGGCGGCGGTGGCGTGCTCCGAGACGGCGATGGCGCCGACCGAGGATTGCGTTGCACG
TATCTCTACCACGAGATGACGCCCGGGGCGCGAAGCAGCTCGGCAGAAGTGTCCATGGCCGTTGTCCAGAAATGGGTGCG
CGACCATCTTCTCAAAAGCGTGAACAGGCACGCTGCAAGCCAGCTGCAGTGCAAATCGCGACACATCGAGATGGTCGGCA
GCGCTCGCGAGGCGCCGAGGCAGCGCAGCAAAGTGCAATGGGGCAGCAGCGTCGAGTTCCGTCTGCGTGATGACGTCGTC
GAAGCTTTTGCCGATGACGAGACCTGGCTGCTGCCGCTGACAGAAACGTGCATGATCTGCCTGGAGGACAAGGCCGTCAC
GGAGATGCCACACCGCATCACGGCTGCATGTCTTCGTCATGCCAACCACAGCCAGCGTCACACGCCGACCCTCTGCAAGC
CGTGTCTGGCAGAGTGGATTGGCTCAAGCCTGAAGGGCTCGGTCTGGAACCGGCTGCGATGTCCCGAGTGCCCGGCCCGG
CTGAGCTATGCCGATGTCCGGTTGTACGCAACTCCATCCGTCTTTGAGCGCTACGACACGTTGGCAACGCGGGCAGCCCT
GGTGAGCGAGTTCCCAAACTTCCGTTGGTGTCTGGCCGTCGGATGTGAGGCCGGTCAGATCCATGGCCCGGCAAGCCGCT
CTGCCAGCGCTCGCTCCGTCGAAGAGGAGTGTCCCAAGTTCCGCTGCCATGCGTGTCGGGCCACTCACTGCATCCGCCAC
AACATACCCTGGCATTCTAGCGAAACGTGTGCCCAGTATGACGCTCGAACGCAGCGTCGCCGGCAGGACAACCGCAAGTC
GGAGGCATTCGTACAAGAGACGTCCAAGCAGTGTCCGGGCTGCAACAAGGCCGTCTTCAAGTATTCGGGCTGCAACCATA
TTAGCTGTGCGTGTGATCTGCCCTGCCTTGAATCTTACCTTAATCTGCTCCCCAAACTGACCATCGTCCCCAGGCATCTG
TGGGCATGAATGGTGCTATATATGCTTTGCACCATTTGTCCAGTCAGACTACGGTATACTCCGGTGCCAGCACAAACCCG
AGTGCACGGAACAGGACCTGTTCGATGAGTTGGGCCTCAATCCCAACAGGCGCCGGGGACCCAGACCCGTGCCTCTTCTC
TGGAGGGCCGGACAACAGCGGCCAAGATGGGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62