GenePrediction:GLEAN_158 Details

Name: GLEAN_158
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1093416..1095284 (+ strand)
Length: 1869
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1093416..1094451 (+ strand)
Length: 1036
Type: CDS
Source: GLEAN
Position: GCSC_179:1094596..1095284 (+ strand)
Length: 689
>GLEAN_158 class=GenePrediction position=GCSC_179:1093416..1095284 (+ strand)
ATGTCTCCCAGCGAGGAGACTAGACGCCCCGCCAATGCAGGTTGGGGTGAGAACCGCCATCATGAGAACAGCCATCTTTT
GCGGGCTGGGCTGCTCTCACAGATCTATGAAATTTCTCGCTCATCCGTGAACGCTAAACAAGGCCTCAATAGCATCAAAC
ACCTGATTGAATGTCATGGTCGGAAAAAGAGCGTGGAGCCAGTAGCTTCAGCTACTTCTCAGATGACCACTCATCACATT
AGTCCGCTGACGCCACCTCGTAGCACATCTGACGATACGTCGGCGGAAACTTACAGCACTGAAGCTTCCATCCGTGATAG
AGATGACAGCACTGAAGAAAGTGAGAGTCGTAGCCCCTGTGATGAAGACGGCGACACAAATAGGGGGTTTCTGGCAAGTC
TCGCGGAAAAACAAGCGCAAAGCAGTCTCAGAGAAGATACTGAAAACTTGTGGAACGAGTTCTCTCTCGAAGAAGAATTA
GAAGGGATCGCAGATGCCCCAGCACAAGATCGCGCTGTTATGCGTGCGGCGATGCATGAGAGAGAAAAGGCACGCAAAAA
ATGGCTACAAGAGTCCGCAGCTGAGAAGCGACGAATTGCTGAGAGAGAGGGCCTGAAACTGCAAAAGGCATTCAGAAATG
CAGCATTCAGTGCTCCTCCAGATTCGCCTGCACAGCACAAGGACTGCTCTAGTGCAGCTCAAGTGTTCACGACTGCGACT
GCCGCTGCTCCCCAGGCATTTCCTACTTCAAGCAAAAGCTCTAGTGAAGTCCATGTCGTCGCCAGAAAATCCATGGTTGA
AGACGATGACGACGATGAAGATGGTGAGAAACGCACTGGTCAACAAATCAGTCGCTGGCAATCGTCTGACAAGCCCAAAG
AGGCGACTTCTCCAGTCATCATTAGCATCACAGGGTCCCCCACCCGAAACGTCGACAGATTTGGTATTGAGTTCGCACCC
GAAAATCTGGCCAACAATTTTAATAAGGAGAATCACCGGCGTTCAATTCTCATCCAGAACATACCGCACAGCTTTAGTAT
GCACAATTTTCTTTCGCATGTCCACGGAGGGACAATTGTCTCCGTCAGACTGATTCCTGAGACATCGAGCCTTGGGAGTG
GACAGACCGGGGTTGTTGTTTTGTCAAAGTCAAGTGAGGCGAGTCTCTGTTGTCGCACAGCCAGGGAACATTTCGGGCAC
CCCGCTTCCGGAAAAGGGGTAAGCGTCTCTCTTCTACCAATGCCCACATACCCAACTCCTGAATCGCTGGCATACGAAGG
AGGTGAAGCAGTCAGCCCCCCCGGACTACCGAGGCAGACACGCTGCTTGCTGATTGACAGCTTTCCGAAGAAATTCGTCA
ATGAGCTCTGTATCGAGCTCCTCTTAGATGTCCGCCACACCCCAACGAAAATTCAGACTTTGGAGGAGATGTGGTTCGAA
GATGACACCCTGCACATCAACTTCACCAGCATTCGAGAAGCGGTGAAAGCATACAACACTGTCAAGTACTTTTACTTTGG
CAAGTTTAGTATGAATGCACGGTTCGGAGTCGATCCTTGCTCTCTACCAATTTTAGAGAAGGTCGATGCAGTTGGCAACA
TTAAGTTGGCAAGCCACGGTTGCGTTCGGCTCAAGTCTCTCATTGAAACAGTGGGGCTGGCGGCATACTCGCGGAGCCAT
CGCGACGAACATGACCATAGTGTCAGCAATGCCCTCTCACACAAAGCAGAGGAAGAAGGAAAACACAGTTCGAAGGTTTC
TGCTCTTCTCGCTGGTGATACCGCAGCTGCAAACAAGCCAAGCACAATGGGAATCGCGACGACCATGCCATGGACCGAAG
AGCTGATGAAGGGCCTCGAGCTTTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62