GenePrediction:GLEAN_1591 Details

Name: GLEAN_1591
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:836120..840176 (+ strand)
Length: 4057
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:836120..836136 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_82:836191..836309 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_82:836528..839964 (+ strand)
Length: 3437
Type: CDS
Source: GLEAN
Position: GCSC_82:840027..840176 (+ strand)
Length: 150
>GLEAN_1591 class=GenePrediction position=GCSC_82:836120..840176 (+ strand)
ATGAAATTTGGAAGGAAGTACGTTACTTCCCTCGCACACCCGCGAGCAACTTTTGTCACTAACACTTTCAGTCTTCCGCG
AAACCAGGTGCCCGAGTGGGCTTCCTCGTACATCAACTACAAGGGCCTCAAGAAGCTCGTCAAGGTGGCCTCCCAGACCG
CAGAGAGGGGGGAGACCGCGGATCTTGCAGGTGGGAAATCCCGCACCTCTGCTGCGCTTTTCAGCATCACTTTGCCCTTT
CGCCCTTCTTATGCTGCCCGTCGTGTGTCCCATCAAATGTTTAAATTTACCCCCGTGCGCAATCCTGATCTGTCTTCAAC
TTTAACTTTCTTTTGTCTCGTGTCTTTTTCTCTACCTCCTGGAACGACCCGGGCCGTGAGCCTAACAAGTCATTTCCATT
GAGAACAGAGTTTTTCTTCGCCCTGGACCGGAATCTGGAAGACGTCGACTCCTTTTACAACAAGAAATTTGCCGACACTA
GCCGCCGCCTTCGTCTCCTTCAAGACCGCTACGGAACTTCGCCCGAGGTCGTTGCCCATCTCGACCAAGATGAGATCGAG
GAGCTCATGGGGGCCCTGCTCGAGCTGCGCAGCCAGCTTCGCAATCTACAATGGTTTGGCGAGATCAATCGCCGTGGCTT
TGTGAAAATCACCAAGAAGCTCGACAAGAAGGTGCCTAATACATCTACCCAACACCGCTACATCGCCACAAAGGTGGATC
CCTGTCCCTTTGCTCGTGACACGGCAATTTCTCGTGTCATGTCCGAGGTCAATCGCTGGCTCCTAGCCCTAGGCGATGTC
AATCAGATCGACGATACCAGATCCGAGCGTTCTACCCACTCTCTCGGCCGTGTCACGACCAAGGCCATGCTCAACCTCTC
GAATGCCCTTCTTGATAAGATCGACCAGGCCATTCGGTCCAATGATTTGGGGAGCTTGGAGGCAGGTCTTCGTGAAGGCC
ACGTGGATCTCAGCGGGGAGGATCAGACCTCGCCGTTAACGCAAGGTCTCTTACTCAACCTGCTCCAGCGGGCCATCTCA
GCTCGCTCTCGCGACACCATCCGCTTTCTCCTGGGCCATTTGCATTCCCTGGACGAGCCGGACGACATAAACCAGAGAAA
CTGCATCCATCGCTTGGTCATTCATATTGGCCGCAGCAAGTCGACACCTCCCATCGCACATCAGCAAGAGGCTGTCAGTA
ACCCGACGCCGTTTCAGCTCCGGCACACGAACCACTATGCCACGCAATATCTAACTCCAGCCGCTTCACCATTGCCTGTG
CCGCGTGCGAGCCACACCATTGAATCGCAGCTGCTCGAAGCTAGCGATCCACGCGTGCAATATCTCGTCTTCCTGCTAGA
CAGTCTGAGTCGTGAGCAGCAGCCTGCGCTTCAGGCACGTGACTTGTTCGGCCGTATGCCGTTGCACTATGCAGCGCAGT
TCGGATTTGTCGTCGTGTGCGAGGCTGTCATTTCCAGGATGCAGGCCTGGGGACAGTTCAATGTTGAGAACGGAATTGAC
GCGCCCGAGTGGCAGGACAACGAGGGATATGCACCAATACATCTCAGTGTCATTGGCGGCCATCCATTGACGACCAAGGT
GCTTCTGCATAGCGAAGACTGGAAGGGGACCAACGAGAGCAAGAGCCATGTGCGTATGGCCAAATCCAGCGCCGTTCTTG
CTATTGCTACCAAGCACAACCACTTTGTCATAGTGCAGACGCTCGTCGATGCCGGAGTGGATATTAACTGGCAGGACGAG
ACGGGCGAGACGGCATTGCATATTGCGGCGCGTTTCGGACACCACCGCTGTGCGAAGATTCTCTTAGCCGGTAGCAATAC
GCAGAAGGCCTCTCCTGATCTTCCCGAGAAGTCATTTGCATGGACACCACTACATATTTCGGCCGTCGATGGCCATCTGT
CGGTGGTACGCCTGCTTGTGGAGACTGGTGCGGATGTCGACAAGGTTGATTCGTCTGGCTGGACGGCTAAGGAACACGCC
GCTCTGCGTGGCCATCTAGACATTGCTAAGCTCTTGCTCGAGTCATCGCGGCTGGCCCCGGGAACAGAAGCCCAGGCGTC
GTTAGAGGACGCCACACCGTCACCTGGCAGCAAGGCGACAACTCCGGAGGCAGTTCCAGAAGCGTACCTGTCGCTGGGTG
ACCGGACGTCCAACAGTGCCTCGCGCCTTGCCTCGGCTTTGGAGCCGCTTCCGCCACCTGTCCGGACATACGGCCATCGC
TATCTCAAGGACGAGACGCTGGTACTTGTCAGTCTCGGGTCGATGGACATGCGCAAGAACACTGACGCGGTCAAGCTGGA
CAAAGTTCCACTCGCGGAAGCGCACAACACACAGCTAGACACGGCGCTCTCGATCGTCGTGTCGGCTCACGGTGCAGTGG
GCGAGCCTACGGTGGTGGATCTCCCAGTGCAAGAAAACATCTCGACAGAGCCTATTGTGTTCACGACAAAGGACATGAGC
GGCGTCAAACTGCTTTTCGACATTGTCCCCACATACTCGGGCAATAAGAAAAACAAGATCGGACGAGGCGTAGCCCTGCT
GTCGACGGTGCGGCCGACCATCGGCTCGAAGCGGATGAACTTACAGGGCGACGTGTGCGTGCCAATCATGTCGGCGGATC
TGGAAATAATCGGCACGGTCAACTTCAATTTTCTGGTGATCACGCCTTTCATGCACCCGAACATGGAAGTGAATGCGGAA
CACACGTATTGGCGCAAGGTGTCGTCGGCGCCAATGGTCATTGGCCACCGCGGAATGGGCAAGAACATGACTTCGAACCG
GTCGCTGCAGCTGGGCGAGAACACGGTGCCATCGTTCATTGCAGCGGCCAACCTGGGCGCCAACTACGTAGAATTTGATG
TGCAGTTGACCAAGGATCACATTCCCGTGATCTACCACGACTTCCTTGTCAGCGAGACGGGCTTTGATGCTCCTGTGCAC
ACTCTGACTCTGGAGCAGTTCCTGCACATTAACAGTGGCAGGATTCGCAGCGGCAGCAAGGGTGACGGCCACACGAATGG
GCACGGCGCCACAAACGGCAGCCGCACGAGCGGAAAGGCTGCTGGAGCCTTGGCGTCGTTGCTGAGTACCACGCCTGCGA
ACAAGTCAGCTGCAGCCGGGGAGTCAGACGGCACCACACAAGGCGGCGTACAGCTTCCCGAGAGCATCAACGGAGGTGTT
GGCAGGGGCGGCCGCAGCCGGGTTGGCGGGACGTATCGGCCGCCGCGGCGAGCCATGTCGATGTCGCTGAGTGGGACGGC
CGACGAACGCACGGTGCTAGAAGAGCGGATGAAGCACACGCGCGACTTCAAAGAGAAGGGCTTCAAGGCCAATTCGCGCG
GCAACTTTATCCAGGCGCCGTTTGCGACGCTGGAAGAGCTATTTAACCAGGTTCCGGCGTCGGTAGGGTTCAACATCGAG
ATGAAGTATCCGATGCTGCACGAGAGCGAGGAGCATGAGATGGACACATACGCCGTGGAGCTGAACTCGTTCTGTGACAC
GGTGCTGACCAAGGTTTACGAGCTGGCGGGCAGCCGCAACCTGATTTTCTCATCGTTCAATCCTGACATCTGTCTCTGCC
TCTCCTTCAAGCAGCCCAATTTCCCCATCATGTTCCTCACGGATGCGGGTGGCGAGCAGGTTTGCGACATCCGGGCGAGC
AGCTTGCAGGAGGCGATCCGGTTTGCGCGGCGGTGGAATCTGCTGGGAATCGTAAGCCTTGCGACGCCGTTTGTGAACAG
TCCGCGTCTGGTGCGGGTAGTCAAGCAGAGCGGGCTGGTGTGCGTGAGCTACGGAACTGAGAACAACGACCCAGAAATGG
TGGAGGTGAGTTTGTGAACGGCCTGCGCGTTGCTAAGAGGTGACAGTATATGCTGACAAAAACGCAGCGCCAAGTCAAAG
AGGGCATCGATGCCGTGATAGTTGACAGCGTGCTGGCCATACGGAAGGGTCTGACCAAGGAAGATAGCAAGGTGGTGGCA
GCAAGTAGCGAGAAGCAGGTGACAGACGGCGTGGCCGTTTCGAAGTTGACTGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62