GenePrediction:GLEAN_1592 Details

Name: GLEAN_1592
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:840914..842499 (+ strand)
Length: 1586
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:840914..841297 (+ strand)
Length: 384
Type: CDS
Source: GLEAN
Position: GCSC_82:841377..841697 (+ strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_82:841759..841982 (+ strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_82:842250..842499 (+ strand)
Length: 250
>GLEAN_1592 class=GenePrediction position=GCSC_82:840914..842499 (+ strand)
ATGGCCGGACCTATGTCTCCTGGCAGCGACGGCCCCAGCTTCGCGCCTCCTCCGCTGCCCGCTGGCTGGATTGCCCAGTG
GGACGCCGCTAGCCGCAAGTACTACTACGTGCAGCTCGCGACGGGCGTGTCGCAGTGGGATGTCCCGACCGACGCAGCCC
TTGCCGGAGGTACACCGACGCCTAGCCACGCCGGAACAGAACATCCTTTCGGAGCCCCTCCGGCCGGGGGGTCTATCGGT
GCGAACGGTGCAAGCTCCATGTTTACGCACCCAGACGGCTCGCAGACCATTCGCCATCCAGATGGACGGCTCGAGCCCGT
GATGCCGTCCGAGATTGGGACACGCGGAGTGTCGGATGGACCCTCTGGGGACCGAAGCCTGAGTGTGAGTGGTCTTTGGC
GGCTTCGGGCCATTGGCTGGAAAACACGGATTTTGCTCTTGCTAACGACGACGCAAATTGCAGTCCTTTGCCGCAAGCCT
GCTACAAGGCCAGCACAGCAACAGCAGCCAGGGCGGATCCAACCCTCTCGGACAGCTGCTTAGCGGGCTATCGCACTCTA
GCAGCGGGAGTAGCGGGAAGCAGAACGGCAGCAGCAGCGGTGGTATCGGTGGCAAGCTGGTCGGACAGCTGGCATCCAAT
CTCTTCTCATCGGGCAGCAAGCCGAGCCAGGCACAGCCACAGACATACCACCAGGGCACGACGGGGCAGACACCGCACGC
GAGCGGCGGGCTGGCAGGGACCGTCATGGGCGGTATGGCCGGAATGTTTGGTGGAGGACATCAGGTAAGAAACGACGAGC
AAGCCGAAGGAGACCGGGGATGAATATTGGCTGATACAAGAGCAGAACCAGGGCCAGAACTACGGATACTCGGGGTCCGG
TCAGAGCGGCACCTACTCGGGCGCTGCGCCGCCCACATCATACCAGCCGATGTCGCAGCCGTCATACAGCTCGCAAGGGG
CGCAGTCTGCCGCCGCCCCTGTGACATCGGCACCACCTGCCTCGTCCTACCAACAACACACGGCTGCGCCATCCTACGCC
CCGCCGCCGGCAGCAGGCCAGCCGTCACAGTACGGGTCGTACGGACAGCCGCAGCAGCCGTCGCAGAACACGGCCCCATC
ATATCCACCACCCCCTATGCAGCACCAGCAGAGCCAGCCACACCAGCAGCACCAGCAGCACCAGCAGCACCAGCAGCACC
AGCATCAGCACCAGCACCAGTCTCACCAGTCGCACCAGTCGCATCAGTCGCACCAGTCGCATCAGTCGCATCAGGCACAC
CAGGCCCACCAGACGCACCCGCAGCAGCCTTCGTACAGCGGCCCGTCTTCTCCCAGCTACGGTTCTCCTACACAAGGCCC
GACCGGCGCGTATGGTGCTGCTGCGACGACATACTACCCGCCACCACCGGGTCAACCGCCGCACCAGCAGAACCAGCAAC
ACCAGTCGCCGTCACCGCAGTACGGCCAAGCGCCACAGTACGGCCAAGCGCAACAGTACGGCGGTGGTGGTCAGGCGCCA
TCGTATGGTGCGCTGCCACAGGCTTCGTACAGCCAAGGCGGGTATGGTGGCCAGCAACGGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62