GenePrediction:GLEAN_1593 Details

Name: GLEAN_1593
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:843977..846238 (+ strand)
Length: 2262
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:843977..845454 (+ strand)
Length: 1478
Type: CDS
Source: GLEAN
Position: GCSC_82:845512..846238 (+ strand)
Length: 727
>GLEAN_1593 class=GenePrediction position=GCSC_82:843977..846238 (+ strand)
ATGGCTGCGCAGTCCAAGCTGACGGCCACGGGGCCACGGCTGCTGGCCGACCAGCACCGCCGCACGGTTGCCTGGGCGAT
TCGGGCTCTGGTCAAGGCGTACGTGGCCAACCGGACGCGCATCTCGCGGGTGGTGTACGTGACGCTACTGGTGGCGGTGG
TGAACCGGGTGCGGCAGGCGATCGCAGAGCAGCGACAGGCCAGCGAGCCGGGAGAGTCAGAACGCGATAGCAGGCATTGT
AACGCGAAGGAGGACGAGGCCGGCAGCGGTAGCAGCGGGGGGGGACGGCAGCGCAAGATGGAGCTGGACCGGGCCTTTTT
CCACTCGCTCGGACGGCTCCTGCGCATCGTGGTGCCAGGATGGCGCAGCAAGGAAGCACGGCTGCTGGCGAGCCACAGTG
CCTTCCTGGTGGCACGGACACTGCTCAGCCTGCAGATTGCGGCCATGGACGGGGCGCTGGTCAAGAGTCTGGTGCGCGGA
CAGGGCCAGCAGTTCCTGCGGCGCATCGCGTGGTGGATGGTGGTGGCGGTGCCGGCAACGTTTACCAACTCGATGCTGGC
CTACCATCAGGCACAGCTGGCACTGCGATACCGCACGCGACTGACACAGCACATCCACGAGCAGTACCTCACGCGCATGA
CCTTTTATGGGCTGTCGGCGCTGGACGACCGCGTCAAGAACCCAGACCAGCTGATCGCCGTCGACGTGGCTCGCTTTGCC
AGCAGCCTGGCCGAGCTGTACGGCAACCTGGCCAAGCCGCTGCTCGACATGACCATCTACACGTACTCGCTCTCGCGCAG
CGTTGGCGGCGAGGGCGTCGTGTCCATGGCCCTGCTGGTCCAGCTGTCGGCCCTGGCCATGCGCGCGCTCACGCCGCCCT
TTGGCCGCTACGTCGCCGACGAGGCGAGGCTCGAGGGCGAATTTCGCTTCCAGCATGCCCGCCTGATCGACCACGGCGAG
GAGGTCGCGCTCTACGCCGGCCATGGCGCCGAGAAGGACACCCTGGACAAGGGCTACTTCACCCTCATCAAGCACGTCAA
CTACATCCTGCGCCAGCGCTTCTACCACGGCTTCATGGAGGATTATGTCATCAAGTATCTTTGGGGAGCCCTCGGCCTGG
TCCTCTGCAGCGTGCCCGTCTTCGTCCCGCTGCCGGCTGCTGCTCGCCAGGCCCTGGCCTCCACCGCCAGCGGCAGCAGC
ATGGCCGATCGAACCGAGAGCTTCGTTACCAACCGCCGCCTGCTGCTGTCCGCCTCCGACGCCTTTGGCCGCATCATGTT
TTCCTATCGCGAGATCATGGAACTTGCCGGCTACACCGCCCGCGTGGCCTCGCTGCTGGACGTCATGACCGACGTGCGTG
CCGGCCACTTTGAGAAGAACCTGGTCTCGAGCAGTGCCGGCAACACCGCTGACCACGCCGCCGTCCTTCGTCGCCGTGGC
TCCGTCGTCGAGAGCGACACCATCCAGTTTACCGACGTGTAAGTTGCCGCTTTCTCTTTCGCACTATTCGCACTGTGTTC
TTGCTGACGCCGCAGACCCATCATCTCCCCCAACGGCGACGTCCTCGTCCCGAAGCTGTCCTTCTCCCTGAGGCCCGGCG
AGCACCTGCTGGTTGTTGGTCCCAACGGCTGTGGAAAGTCGTCGCTCTTCCGCATCCTCGGCGGCCTCTGGCCCGTCTAC
GGCGGCACCGTCCACCGACCGCCACCGGCCGACATTTTCTACATCCCCCAGCGGCCCTATCTGCCGCACGGCTCTCTGCG
CCAGCAGATCACCTATCCCGACAGCCTGCGGGCTATGCGGGCCAAAGGCGTCACGGACGCCGACCTGCTGCAGCTGCTGC
GCTTGCTCAGCCTCGAGGAGCTCGTTGCCGGCCAGTCGGCCGGCTGGGACACCGTGGCCGAGTGGCGCGAGGTTCTCAGT
GTCGGCTGGCAGCAGCGCGTCGCCATGGCCCGTCTGCTCTACCACCGGCCGCGCTACGCCATCCTCGACGAGTGCACGTC
TAGCGTGACCTTGGAGATGGAAAAGACCATGTACGAGCAGGCCAAGGCCATGGGCGTGACCCTGATGACCGTCAGTCACC
GGCGCAGCCTGTGGAAGTACCACAATCGCATCCTGCAGTTTGACGGTCAGGGCCACTACGTCTTCACCCGTCTCGATGCC
GAGCGTCGCCTGCAGCTCGAGGACGAAAAGGACGATCTCGATCTGCTGCTGCGCCAAGTCCCTGACGCAGAGCGCCGCAT
CGCCGAGCTCGAGGCTGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62