GenePrediction:GLEAN_1594 Details

Name: GLEAN_1594
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:856319..858061 (+ strand)
Length: 1743
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:856319..856670 (+ strand)
Length: 352
Type: CDS
Source: GLEAN
Position: GCSC_82:856724..857138 (+ strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_82:857902..858061 (+ strand)
Length: 160
>GLEAN_1594 class=GenePrediction position=GCSC_82:856319..858061 (+ strand)
ATGCGCATTCCGACAACTTCAGTCCTTCTAATTCTCCCGGTCCTGGGAATGGCGGCCGAGGGCGAGGGCCCTTTCGCACA
ATATCGTGCACAGTTTCAGAACTTCATTGGCTCTGTCGGCGCATACATACAGGTGCCTACGCCGCTTTCGGCGAAGGTAG
CCGAGGCTTCCTCGGGTGATGCTGCGGCTGACCAAGCAGTAAAACCGGCCTCAGTCAACACTGTTGCTCGACCCACTGAA
TATCTGAAGCTGGATGACTGGAAGGACATACTCTACAGTCGCGTGAAACCTGACGCCACAGCTCCTGAGGAGTGGTGGGT
ACTGGTTACGGGTGGCAACAAGACGTGTTTCGGTATGTGATTATTGTTATAGATGTGCGCTTCATATCACTGATCTTTCC
GGCAGGGCATTGCGATGTTATCATGAGCGCATTCAACGAAGCCGCGCCTAAACTGTCGGTTATTCTCGATAGCCCGCACA
CGGCAGTCTTGGACTGTGAAGACCAGTCGGTTCTATGCAACAGCTGGTCCGCCAACCCTGGCTACCTCTATGTCTTTGAA
TTGCTGCCTCAACCAGCTAAGACAGATATCTATACAAAGCGGCTCAACCTGACAACGACAACTAGCAACACAATCCAAGA
ATTGTACGAGGGCCATTCCAAAGAGGGGTTTGAGCTTCTTGACAGCTATTTCCACCCACTTGATGGCGCGCTTGCTACAT
ACGGCATTGCTGTTCCTGTCGGTTACGTCCTTTGGGTTTTTGGCGTAGTTCCAAGCTGGATGATGATGCTTCTTATCTCA
TTCGGTAGCCGGACAATAATGTGAGCATTCGATTTCGTCTTAATGCTAGACAGGATACAGGACTAACGTCTCAAAGGGGC
CGTCGGGCCAGTCCTGGCAGACCTACTGGTGGTGCCCCAGCACCCGCCGCGCAATGAACCGGTTGTTTTTTTTGTTAATA
CTGACTTGCTGTCTCAGCGGCTTGCTGTCGTACTTGAAATAGTTCATGCAACTGGCTTAGGGGCAGCAAGGACTGTGTGT
CTAAACCACATCCAGCAATAAAGAAAGAAAAGGTCACAAAGGATTTTTTGCGAAGCCCCTTCTATAATGCATTGTGCTAC
AGTATTCGCTTTCGCGTCAATACACTGCCATTGCAGTAGCATAGACAGTCAAAGCTACCAGGGAATCCTCTGAGCTCGCG
CCGCGGTTCACAGTCGCCTGAAGACAATGCCTGTAAAAATTATGTTTTTCTTCTGTCAGGCTGCCTTGCTTATTGTACCC
TTGGTCATTTCCGTGCGACAAGTTTCCTGAACATGATTTAACCCCCCCAACACCTGGTCGCAAAGATGAGGATTAGCAAG
ACGCCCATAGCGAAGGTCACTAAGGGTGCCAATCGTTTGTTGAATACGCTGTCGCAACTGCGCATCTTCGCTGTCTAGGT
CTTGTAGGTCGGTTTCGAGGTATTGAACGGCAGACCCCAGCTCCGTAATTATAGAAACAAGATCATGCTGGCCACCTTTA
GCACTACCAACGGTTTAGTTTTTTCTGCTATGATGTGTTCAAGTTGAAGTTCATCGTCTCCAGTAATGTCCTCTTGGGCA
TCAGCGCGCAAGCGGGTACGGACGGCGTGGCGGTGAAGCAGACGACCATGAACAGCCTCAGCATTGATATCCGCGGCAAT
CGCATCAACGACAGCATTGCGTTGGCGCTGCAGGTCGCGATAGAGTGTGCGCACCTGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62