GenePrediction:GLEAN_1595 Details

Name: GLEAN_1595
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:858630..860216 (+ strand)
Length: 1587
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:858630..859142 (+ strand)
Length: 513
Type: CDS
Source: GLEAN
Position: GCSC_82:859524..859795 (+ strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_82:859869..859943 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_82:860153..860216 (+ strand)
Length: 64
>GLEAN_1595 class=GenePrediction position=GCSC_82:858630..860216 (+ strand)
ATGGATATGCTATACGAGGCACGTATTCTTGATGTCCAGCAAACTAGCGATGGACAGCGTTGGCGATTTCGCATCCACTA
CAAGGGCTGGAAAAACACATGGGACGATTGGGTACCCCAAGACCGCGTCCGAAAATTTAACGATGAAAACCGCGAGCTAG
CTGCCCAGCTGCGAAACCAAGCCCGTCTGCTGCAACAGCAAAAGAACGCCAGCAAGGTGCCGAAAAAGACAACGTCTGGA
CGACTGAGTGCCGTTGGCCCCTCAGGAACAATATTGGGTGCCACAGGGCTGTCTTCAGTCGCTACGACAGGTGGTTCCGG
GCTCGGGAGTGTCACGCCAGGCGACCGGCCTGGACGAGAGTACCACGCACACGCCCATCACCATAATCACCACACCAACA
ATGGCCGTGAATCGGAGCTTGCATCAGCTCGTGGAAGTGAAGAGCGGACTGGCGGAGGATCTTTGGCGCATGCCCGTGGT
CCACGACGACAGAGGGACTACGACCTCGAGCACGTAAGTGGTTTACCGGATGCTTGCCTGTTTAGCCTGATTCCGTTGCC
GTTTTGGCTCTGCCCGCTTGGTATTTACCTTCTTCTCTGGGCGTTGCAGTACATCATCCCCCCTTTGCCAGCGTCGGCAA
ATCAAAATTGGTGGACTCAGGCCCGTCATAAGACCATTTCAACATATTGCCGATCGTATCTATATCCACAGAAGTGCTGG
ATGGGACTGACAAGGCTTTACGCGAGCCCTGTACATCAGGGCGCAAAGCAAACATTTCACCACATGTCAACAGCATTGTG
GCATATCTCACAAAATACTAAATTCTTCACCCTTTATTCAGTGTAGACTCATATCGCCATGCATCTGCTGAACCTGCTCT
AACAAAGATCATAGGAAGATGGGTTTCATAATCGACCGTCAATTCGACTGGCAATGCCTGACCACCTGAAGGCGGCATTG
GTAGATGACTGGGAGAATGTCACGAAAAACCAGCAATTAGTTCCGTTACCACACCATGTACCTGCCGAGTCCGTGTTGGA
TGACTACCTGTCCTTTGAGAGGTCGCATCGGGAGGAGGGCTCTGCAAGTTTAGACATTTTGGAGGAGACGGTTGCCGGCT
TGCGTGAATATTTTGACAAGTGCCTGGGTCGTATATTGCTCTACCGGTAAATTTATTGCGACCCCGTGTGTGGACTATCT
GTTTTGGTAACAACACTGTTTTGCTAACTCGCCCTCCAGTTTTGAGCGCCCCCAATATATTGAAATGCACGCATTGTGGG
AATCCGGTGGCAAGCACAAGTCACCCCTGGACACGTATGGCGTTGAGCATCTCTGCCGGTTATTAGGCAAGTCTTTATTG
AGCCGTAGCAATTGTCCCTTGCAGATATATATGAGTATCCCACTAACTACATAGTCTCACTCCCGGAACTCATCTCACAA
ACTAACATGGACCAGCAATCCGTGAACCGGCTGAGAGATGAGCTGACAAAATTCACAACATGGCTGAGCAAGAATATGGC
CAGATACTTTGTCAATGAGTATGAGACACCAAATCAGCAGTACGTGGATAAAGTCCGGAGCGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62