GenePrediction:GLEAN_1596 Details

Name: GLEAN_1596
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:865297..867154 (+ strand)
Length: 1858
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:865297..865737 (+ strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_82:866126..867154 (+ strand)
Length: 1029
>GLEAN_1596 class=GenePrediction position=GCSC_82:865297..867154 (+ strand)
ATGTCTGCTAAGTCAATTTTTGAGGCCGACGGCAAAGCCATCTTGAACTATCACCTTACACGTGCTCCGGTCATCAAGCC
TTCGACCCTTCCAGTGGCGACGAAGCACAATCCACCACCGAGATTGGCCTCGCTGCATTTTCCCGAAGATGAAAGCGTTG
AGTCGGTCTTGGATCAGGCCGAAGTCACCTACCCGTGGCTGTTGCAGTCCAGTGCCAAGTTTGTTGCGAAGCCTGACCAA
CTGATCAAGAGACGGGGGAAAAGCGGCCTCCTCGCTCTCAATAAGAACTGGTCCGACGCCCGTGCTTGGATTGCAGTGCT
GGCTGGTAAGGTCCAAAAGGTGGAAAACACTCACGGTGTTTTGCGACACTTCCTTGTTGAGCCGTTTGTTCCCCACCAGC
AAAACGAAGAGTACTACATCAACATCAACTCTGTCCGCGATGTGAGTGCTGGCGTTCCCTTTGAACAGTTCCGCCTTTCC
TCCCCTTTATTGCTTTTGGTCGTTGGTAGTAAAAACAAGGCTCGATTGGATGTCGGGTGTAGGGAAGAAATGGGTGCGAA
CGCAGAAAGAAAGGGGAGAATGCCAGAAAAGATAAAAGAGCAAAAGGATTTGGGGTCATGGGTTCTCTCGTGTGGCATAT
CCCCTTTTATGAAAGCGAGCAGCGAATTTGTCCGAAGTCACGGGCCCGGACGAACGGAGGCTAAACTGGGATCGATTTGC
CCCGGATCTGGCTCCTGCTGCACTAACACATATCCATTCCTTACACCCACACCAAGCACCAAGCGCTACGATACCAAAAC
GGGTCACTAATTATTTCATGAATCTTTAGGGAGATTGGATACTCTTCACACACGAAGGTGGTGTCGATGTTGGTGATGTC
GATGCGAAAGCCGAGAAGCTTCTGATTCCCGTTGACCTCTCTGACTACCCGTCGAATGAGGAGATAGCTTCTACCCTGCT
TAAAAACATTCCCGAAGGCCTGCATAGTGTCCTGGTCGATTTCATCACTCGTTTATACGCGGTCTATGTTGACTGCCAAT
TCACGTATCTGGAGATCAACCCTCTCGTGGTCGTTCCAAACGAGGATGCTACGTCGGCCGCTGTCCATTTCTTAGACCTC
GCAGCGAAGCTGGACCAGACGGCCGATTTTGAGTGTGGAGTGAAATGGGCTATTGCTCGGTCACCTGCTGCGTTGGGTTT
GACCAATATCGCGACTCAGAGTGGCGGTGCTGTCAACATCGATGCAGGCCCGCCCATGGAGTTTCCGGCGCCTTTCGGTC
GTGAGCTGACAAAGGAGGAGGCATACATTGCCGAGTTGGATGCGAAGACGGGTGCCTCGCTCAAACTGACTGTTCTCAAC
GCCAATGGCCGTATTTGGACTCTGGTGGCCGGTGGTGGTGCGTCGGTTGTGTATGCAGACGCCATTGCATCGGCCGGCTT
CGCAGACGAGCTTGCCAACTACGGCGAGTACTCAGGAGCACCAACCGAATCACAGACTTATCACTATGCTCGCACTGTCT
TGGATTTGATGCTGCGGGCTCCTATGAACGACAAAGGCAAAGTCCTATTTATTGGAGGTGGAATCGCAAACTTCACAAAT
GTGGCATCAACCTTCAAGGGCGTGATCAAGGCTTTACGAGACTACGCGAAGGCGCTAAACGAGCACAATGTTCAAATTTG
GGTGCGTCGTGCGGGACCCAACTACCAGGAAGGTCTAAAGAACATGAAAGCTGCTACCGAAGAGTTGGGGTTGAACGCAA
AGATTTTCGGTCCCGAAATGCACGTATCTGGCATTGTTCCTCTGGCTCTTATCCCTGGCAAGTGGGAGGAAGCAAATGTG
GAGGAATTTAAAGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62