GenePrediction:GLEAN_1597 Details

Name: GLEAN_1597
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:875672..876384 (+ strand)
Length: 713
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:875672..876059 (+ strand)
Length: 388
Type: CDS
Source: GLEAN
Position: GCSC_82:876133..876204 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_82:876284..876384 (+ strand)
Length: 101
>GLEAN_1597 class=GenePrediction position=GCSC_82:875672..876384 (+ strand)
ATGGGCGAAAGACATGCTGCCTACCAGGACAGGGGTGTAATACCATCCAGAAACGAGACAGAACAATATTCTCTTAGCCG
GAGCACCGTGTCCGCTTCTGCATCTACTCGTACCCATCTTCGCCGCAATCTGTTTCAGAGCCACCTGACACGCAGGCCAA
CGACAGGCGCATCCGGCATGCTGCCCTCTACCGCAGCATCTTCCAACATCTACCCGAACATGGACGGAGGTGTCGTTCCA
GATCTCGGCCCGCAATTATCTGAAAAAAACGATATCAATGAGATCATTGCGCGTGACGTCAATGGCGATGTTCAAATAAC
TGACCCGCCGTCGCCGACACCGGACGAGATAAAAGACCCAGGCTTTGACGAGCGTCAGGAGAATGAACGTATGCTCTCGT
GTATACATCAAGATGGTAGTTTTATAGTACATCATACTAACCCGTTCATATATGTTCTCAGGAGAAAACCAGCGCCTAGC
TGATACCATTAAGTACCACCAGCAACGGACGAGCAGTACCGGACAACCCGAAGGTAACACACCCTCTTCAGATCTGTGCA
AAATCATTCCAAATGTTGGGACATTCAATCTAGTCTAACAAATTCCAAACAGAGCTGTTGGATGCCATACGGGCAAGTTT
GAGAGCCAAGGTTACTGCGCTACTCGAGGACAACTGGATATACGAAGCCAAAGACATGCAACGTCCAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62