GenePrediction:GLEAN_1599 Details

Name: GLEAN_1599
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:882086..886646 (+ strand)
Length: 4561
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:882086..882212 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_82:882366..885124 (+ strand)
Length: 2759
Type: CDS
Source: GLEAN
Position: GCSC_82:885190..886550 (+ strand)
Length: 1361
Type: CDS
Source: GLEAN
Position: GCSC_82:886607..886646 (+ strand)
Length: 40
>GLEAN_1599 class=GenePrediction position=GCSC_82:882086..886646 (+ strand)
ATGGAACAACAGCAGAAGCCTGCCTCGGGAGGCGTGCCCGGATCAGCCGGCCGACGACTTCACATCGCTCATCGACGAAG
CCCCTCGGAGCTCACTCCGCTCATGAGCATGTTCTCCAATACGAACAGTAAGTATATAATTTACAATGTTATTCTATATG
TCTTTACTTTATATCGTAGTGAACGACCTACTATTTTTTGCGCGTCTTGCACATGGCTCGTCGTGGTGTGACGTTCCGTT
GTTTCGTGTCGGCCAAACTGACAGATTTGGCGATCAATAGTGGATCAACTTGCTATTCAGCAGCAGATCGAGCTCCTGCA
GCAGCAACAACAGCAGATTCAGGCGACTCACCAGCAATATGTTAATATGGGCATGCTTCCCCCTACTCAAAGCCTCGGGT
CAGGAGGCGCTTTCAATCATTTGCAGCCCTCGATGGCGAATATCTCTCCTCAAGCAGGCTTTCAATTTCCAACCCAACTA
CCACAGCAAAACGTTGCTATGACGTTGCCTTCCCAACCTCTCGCGCATCGCCGTAACCAATCCGCTCTTCCGAACATGGG
CGTCGGACCCCCTCCCGCTCCATCCTCGGGAGCTTCTGGATCTGCTTTCGGCAACTTCGAAAATTCTACAAACTATAACC
GAGAGGGCGGTAGCAACCGTGGTGGCCGTGGTGGAGGTGGGCCTGGCGGTGGTCATCAACGGCGACATTCCCTAGCTTTG
GCTGACGCAAAGAAGGCAGCTGAGATCGCCCAACAGAAGCGTACAACTTCTGGATTCCAATTTCCTGCTCCAGGCATAAC
AAATACTTCAACGGTTGATAAATCTGAGGACGATGCCAAGACTGTTCCTGCCGCTTCTGCCATCATTGCACCTTCCCCGA
ATCCTGAAAGCCAATCTAATACAGTCAACACAATTTCCGGTCGCGGACGTGGGTCCGGACACGGCCGGAGTCAGAGTATG
GCTGTTGGACGAGGTGCTGGGATGGGTCGAGGTGGCATGGGGAGTTTCACAGCCGATCCAGCTCAAGGCGTGAGCCACGA
TTTTCAGCGTCGTAGCGGAAGCCACGCGCGGACTTCTTCTCGCAATTTCGATGGGAACTGGCGAAACCAAAGCCAAGGGC
AGGATAATATTGGTATAACCCAACAGCAGCAACAGCAACAGCAACAGCAGCAGCAACAGCAACAGCAACAGCAACAGCAA
CAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAACAGCAGCAGCA
GCAGCAGCAGCAGCAACAACAGCAACAAGGGGGGTTCCAGCCGGGTCATCGGTCCCGCGGCTCGATGAGCGGCCAATCAA
TTGGTTCCATTGGCGCCTTTCAGTATGCTTCCCAACCTCAACTGATGCATCTGCCTGGCCAGATGGTGATTCCAGGCGTC
TATCCCGGACAGCAGCTTAGTGCCGTGCAAATAAATCAACTACAGGCCCTGCAAGCTGCCCAGATGGGCAATCAAGGATT
TGTTGGCCTCCAGGGAAGCCAACATGCGGCACAACTACCGCCTCAGCAACAACAGCAGCAGCAGCAACGGAAGACACTCT
TTACTCCATATTTGCCGCAAGCCACACTGCCTGCCCTTCTCGGAGATGGCCAGCTGGTATCTGGCATTCTCCGGGTGAAC
AAGAAGAACCGGAGTGATGCGTATGTCACGACACAGGATGGTCTTCTTGATGCCGACATTTTCATCTGTGGAAGCAAAGA
CCGCAACCGAGCTTTGGAGGGTGATTTGGTAGCGATCGAGCTATTGGATGTGGACGAAGTCTGGTCTCAGAAACGTGAGA
AAGAGGAGAAAAAGAAACGCAAGGACATCACCGACACTCGCTCTAACTCTGGAAATGCGCCTGGTCAGGGAAATGGGAAC
AGCGATGACAACATTAATGCCGAGAGTGGCATCCGTCGCCGTGGCAGTCTTCGACAGCGTCCCACTCAGAAGAAAAACGA
CGACGTGGAAGTCGAGGGCCAGAGCTTACTTCTTGTTGAAGAAGAGGAGATCAATGATGAACAGAAACCACTATACGCTG
GGCATGTGGTGGCCGTTGTCGAACGTGTGGCTGGACAGATGTTCTCCGGCACTCTTGGGCTTTTACGACCCAGCAGCCAA
GCTACTAAAGAAAAGCAAGAAGCAGAACGGGCTGCGAGAGATGGGAATGGCTCTGGGCGCCACCATGACGGCCGGCACCA
GGACAAGCCGAAGATTGTGTGGTTTAAGCCAACAGATAAGCGCGTTCCGCTTATTGCTATTCCAACAGAGCAAGCCCCTC
GTGATTTTGTTGAGAAGCATCAGGAGTATGCGGACCGCATTTTTGTGGCGTGCATCAAGCGCTGGCCGATTACATCACTG
CATCCCTTTGGTACGCTGGTGGAGCAGCTCGGCCGAATGGGTGACCTCAAAGTCGAGACCGATGCGCTTTTACGGGACAA
CAACTTCGCGTCGGATGAGTTCTCTGATGCAGTTCTCCGCAACGTCACGCCCCAGGACTGGTCCATCACGAAGGAAGAAG
ACGTTGCTATCAAATCACGGCGTGATTTTAGGGATGAAAAGGCGTTCACTATTGATCTGAACGGTTCTGCAGAATTGGGA
AATGCGGTGCATGTGACCTCTGGACCGGACGGGAAAGTCGAAATCGGTATACACGTCCCAGATGTTGCCCATTTCGTCAA
GCCAAATACTTTGGTCGATAGGGAAGCCAAGAAGCGTGGAACTGCGGTTCATCTCTTGAATCGGACCTGCGCCCTACTTC
CACCGAAGTTGTCAGCTGGATTCTGTTCACTCACCCCTGGCGAGGACCGCCTTACCGTCAGCGTTGTCTTTCAGATCAAC
CCACACAATGTAACTGTTGCCGAAGGGGATATTTGGGTCGGGAAGAGCATTGTGAAAAGCCACGGGAGAGTGACTCTGGA
CCATATCAACGATGCCTTGGCGCATGGGCAAGACTTCAAGCATGATACCGTCTCTGCCAAAGATGTCCAGATTTTAAACG
TATGCTTGCATACTTTCCCGGATGGCGACCTGTTGTATGACTTCTGCTAACTTCTTTGTATTAGTTTGTCACGCAAAAGT
TTCGCGAGGCCCGTCTCGGTGCTGGAAGTGAACCCATTGCACCTCTTAGGCTGTTTCAGCAACTAGATGATGAGAACATT
CCCATCGAGCATAATATTTTCGATACTACAACGGCTGTGGAGATTGTCGAAGAGCTCATGCACAAGGCCAATGCTACCAT
TGCGCAACGGCTAGTTCAGGCTTTGCCGGATAAAGCAGTGCTTCGCAGACAAGCAGCACCAAGTCCACGCCGCCTACAAA
CAATTGTGGAGCGAATGACTGCTCTAGGCTACGAGATCGACTCGACTAGCAGTGGTACACTTCAAAACAGCCTCTTCAAG
GTCGAAGATTCTGATATTCGGAAGGGTATGGAGACGCTGCTTCTGAAAGCGATGCAGCGGGCGAAGTACTACGTTTCTGG
CAAGACTGCAAAACATCTCTGGCCCCATTATGCCCTCAATTTGCCGCTCTATACTCACTTCACAAGCCCTACGCGTAGAT
ACGCCGATGTCCTTGTGCACCGCCAACTGGATTCCATCCTTTCTGATGGAAAGGTTGAGTACGCGGAGGATCTTGAGAAC
TTGGTCAAGACGATTGAGGCTTGCAACACGAAGAAAGACTCTGCTCAAAACGCTCAGGATCAAAGCGTGCACATTGAATC
CTGCCGCAAGATGGACAAGAAGCGCCTTGAGACTAACGGAGACCTCATCAGCGAGGGTGTTGTTGTCTGCGTTTACGAGT
CTGCTTTCGACGTTCTTATTCCAGAGTGGGGCTTCGAGAAGCGGGTGCACTGCGACCAGTTGCCCCTCAAGAAAGCCGAG
TTCCGGAAAGATAAACGTGTTTTGGAACTGTATTGGGAAAAGGGCGTTCCCAGCTCGGCGTATGTACCAGAAGACGAGCG
GCCCAAAGCGGCTGCATCTCTTCGCGTCTCAAATGCGGCTGCAGCCGCAAGACAGCACGAGGAGGCTGAGCGTGTGCGAA
AGGAGCGCGAGGAGGCTGCGCGCAAGCAAATCGACACTGGCACGATCTCAACTGACGATGCAGATGCTTTGTTTGATGAC
GACGACGACAACGGCTCTGACATCACAGAAGCAATGGCAGGCGCTTCTTTGGCAGAAAGGCCGACGCAGAGCGTGCCAGG
TTCGCCGTCTCGGCTCGAGGCTGCTGTGGACGCAACTGCTTTGCATCGGGCACGGTCAGACTCAAAGGTGCCTGCTGCAG
AGACGCCAGAGGCTCGCCTGACCAACAGGGAGAAATATTTGAAGATGTTCAAGCTTCGTGAGGAGGGCGGCGAGTATATT
CAAGATGTGACGGAGATGACACGTGTGCCGGTTATTCTGAAAACGGATCTGAGCAAGAGCCCCCCGTGAGTGTTGCTCGA
TTATACCAGCTCGCCATTTCATGTGCTAACGTCAGTTGCAGGTGTTTGACTATCCGGTCGCTGAACCCGTTCGCTCTGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62