GenePrediction:GLEAN_159 Details

Name: GLEAN_159
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1097946..1098894 (+ strand)
Length: 949
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1097946..1098671 (+ strand)
Length: 726
Type: CDS
Source: GLEAN
Position: GCSC_179:1098721..1098894 (+ strand)
Length: 174
>GLEAN_159 class=GenePrediction position=GCSC_179:1097946..1098894 (+ strand)
ATGGCTGCCATGTTCACCCCGACGGCATCGGCCATCCGGCCAAGCTTAGCCGTGGCCCAGCGCACCAGCCTGCAGGGCCC
TGCAGGATTCCTTCTGCGGCAAGCCAAGCCGGCGGCTCTACGACATGCGTCCGGGCGGCCGTATTTTTCGTCGCCGCCGG
TAACATCGACGCGTCTCGTCTCCCTTTCCAGCGACTGCCTGAACCTGAAGAAACAGACAGCGGTGACGTCGTCGCCTTCG
TCTCTGTCAACGGTGGGAGCCATTGCACTGGCCCGGTCTCGTCGATGTGCGTTTTCTTCGTCCTCATCGTCGTTGTCAGC
GTCGCCGTCGCCGCCCGGCCGCCCGGCCGCCCAGCAAGATGCAGCCATTGATGCAGCTGCGGCCGCAGCCGTGTCCAAGG
CACAGCAGACAGCCCATGCTGACCTGCCACCACTGGATTGGAACACGTTTTTTCAACTGCGCAAGACCCGCCGGCGGATC
CAGCTCGTCTTTAGTATCGTCGGCGGTCTGTCGGGTGGTCTGGCCGGCGGCCTGTTCCTCGGCTCGGGCGTCGCGGAGCC
ACTGATTGCACAGGTCCCATTGGACCCTTTTCTCACCCTCGGACTGATGACCTTTGCCTTCTCCTCCCTCGGCTGGCTTG
TCGGTCCGAGCGTTGGCAACGTGGTGTTCTACGCGTGGAAGCGACAGTACCGGGCACAGATGACGCTGGCAAGTTTACAG
ATCCGGGTGCAAATTCAATGCAAATGTGTATACAAGCTGAGCTGACCCCTTGAAGAAAGAGACACAGTTTTTCGCTCGCG
TCAAGAAGAATCGGGTTGATCCGTCAGCATCCTCGGCCGGTAACCCCGTGCCTGACTTCTACGGCGAGAAAATCTCCAGT
GTGGCCGGTTACCGGCAGTGGCTAAAGGACCAGCGGGCTTTCAACAAGAAACGGACAACATTTGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62