GenePrediction:GLEAN_1602 Details

Name: GLEAN_1602
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:899890..900846 (+ strand)
Length: 957
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:899890..899911 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_82:900115..900260 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_82:900319..900846 (+ strand)
Length: 528
>GLEAN_1602 class=GenePrediction position=GCSC_82:899890..900846 (+ strand)
ATGCCGTACTCGACCGGCATCTGTACGCTACCGCTATTTCACACAGTGACACTTCTCCTGTCGTGTTTCTCCATCTTGCT
GCCCATACCAACTCTGATATAATCGCTTTAGTTCCTATCATATAATAGCGAAAATGAGTGGAGCTAAACAACGGCTCATG
TCGGAGCTTCATGCCCTACAGAACGAGAAATGGGTGAATATTGAGGTATTTGACTACTCTCGTAGATCACGAAGGCCGGC
CTCTCGGCCTGACGATACAGCCCTTTTCAAAGCGTACTGACAAAGTTCCCAAGGCCGACGACCTTTTTCGATGGCACCTA
GGCCTTATGGTTATCAACCCAGATAGTGCTTTTCACGGTGGCTACTTCAATGTAAGAGCAAAACGTAGAGCAAATCGAGA
ATGCTATGTGGACTGACTTCGATGCATAGGTAGAGATACGGTTCACGAATGAATACCCATATAAACCGCCTACGTTCCGC
TTCACGCCGGCGATCTTCCATCCCAATATTTACCCCGATGGCCAGTTGTGCATTTCTATTTTGCATCAACCAGGCGAGGA
CATCATGTCCGGTGAAGCCGCAGGGGAGCGGTGGTCGCCACTGCAAGGAGTCGAGTCTGTATTGCTTTCGGTGTTGTTGT
TGCTAGATAACCCGGAAATCTCGTCGCCTGCAAACGTCGACGCCGGCGTATTGTATCGTGATAACCGCTCCTTGTACAAT
GCACGGGCGCATTCCGCTGTGGATCGATCGAAAAAGGATATTCCGCCAGATTTTGTTATGCCTACAAAGTTCGAAGAAGA
GCCACCGAAAGCAACCGTCAACGATGACGCTTTTTGGGCCGAGACGGATGAGGAGTTGGACTTTGGCAGCGATACTGGAG
ACGAAGATGAACAAGAGGGCGACTTCGGAGATGAAGACAGAAAGGATGGCGACGATGAGAGTGACGACGACAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62