GenePrediction:GLEAN_1603 Details

Name: GLEAN_1603
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:901742..904848 (+ strand)
Length: 3107
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:901742..901837 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_82:901934..901990 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_82:902072..902300 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_82:902399..902490 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_82:902568..903750 (+ strand)
Length: 1183
Type: CDS
Source: GLEAN
Position: GCSC_82:903817..904067 (+ strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_82:904129..904848 (+ strand)
Length: 720
>GLEAN_1603 class=GenePrediction position=GCSC_82:901742..904848 (+ strand)
ATGGCTGACCAAGATGAGTCATCTGTCGCCAGCGTCTGCGAATTCACTGGCCTAGACCCTGTTGTTTACCGTGAGCTTGT
TGTCTCTGCGCTGAGGGTACGGGATCAAACTGCTCGAAATCACTCGTGTATGGGGAAAAGGGCGAAAGAAATACATTTGG
CTAATCGTCACCCTCTATTTCTATCTCTACAGGAGAAGGCTGGTGATGTGGAAGCCGTGGTAGCCGCATTTTACGACGAC
GAGGTCAAGGTTTGTTTGGGATCTAGAATGCAGACTAGACCCTTTTTAATGCTCATTAAGCTTACGCTGACCCCGTCGTA
TATTATGCAGTTTCGCCAAATGTTTACATGGAACGAGGCACACTTTGTTAGCGATCGTGACGGCACGAGCAATGACACCG
GTCTACCCAAGTTTAACGTCCAGGGACCTGACGATGTTTCGATCATCCATGGTGTATCGCCTACTGGGCACCACCTAGGC
GCACCGTCACGCCCGCCGTCACGGACCCAATCACCGCTGGGCCGGATGGTAGACTGGACAACGCAGGCAAACCGTATCAG
TATGTTGCAACAGCGCTTGCGACAGGACTTTTTTTCTCTTTCTCACCCCCCCGCCGCCCCCGCCCGCGCCCCTAAAGTTA
ACTGACGGTCGAAGCAGGCACTTACAACTCTCAAGCCGAAGAGGACACCGAACTGCAACGAGCTCTGGCTGCGTCCGTTT
CAAGTCTGCACCCACCACAGGAATCTGGGGTTACTGGTGGTGAAGCTGATACCAGTCTGCCCTTTTTTTTGGCCCTGCCA
ACCGAGAAACATATGATCTCAACCAGTGGGCAATGGTGAGGGCTACGCCTGATAACAAGGAGTTGGGCCCATCTTCTAGG
AGACGAGCGCCTGGAACACCGGCCATTCTGCGCTGCCGGAAGGAGGGCAGCGACACATACAACCTTAATGCTCTCCTCAC
CATCTTACATTCCGTGCCTGGAGTTCGTAACACTTTTTTGCGTTCTGGACAACCAGCGAGAAATTATGGACAGGATCCAG
ATTGGTGGAAGGGAAGCCTCTCGTTCTCGATAGGCGAGTCATCACAAGAAGGAGCATTGTCAACAGCGGAAGAATCGGTA
TCGAGGATCGCAACCACACATGACCGCGCGCGAAATTTCACCGAAGAGATACACCGTATAATGGCATTTCTTGATGGCAC
CGATAGGGTTTATGGGTCGGCTGATATATTCTCTAATGCTAAGCTCTTGGGAGAGTTATGGGATGATAAACCGGATCGCT
TATTCTTCAATTTTTTCAAAGAAGTCAATCCCCCTGAAATATCGGAAACCCTTTTCTCGGATATTGGTCTGGTTGGTGCC
GCTGACGAGGACGATTGCACTTATATTGAAAGCTACGCGATTCTTGACGCCAAGATTGAGAGGGGACAATACTTTGGAGA
GTTACGAGATATCTACAACATTCTGGATACCATTTACTGGGTGGATCTTGGGGGTGTGTCGATGGAACCAATAGCCACGG
CTAAGATGGCTGTGTCAACCAGACTCGGCATGATTCAGATTTTCAACATTTGCGTCGATGGTCTCGAACAGCCTGTAGAA
ATCCCGGAAGTTTTTTTTCCAGACAGGTATACGGCGGAGAACCGACAGCTAGCTTTGCAACTGCAGCTGAAGCTACGGTC
CGTCGGTCAAGCGTTTAAGGAGAGTGATGACATGTGCAACAAGATTGCCACATTCACAGACAAGTCGAGTAACTTCACGC
TAAGCCAGGCTACTTTGTCCGAGCAAGCTATCGGGCTAGGAATGCAGAAGCTCTGGCAACTCAAGGCTGCTGCGTTTTGG
AAGCAACACGAGGTATCGGTGGGGACGCCCGAAGAGTTTGACTTCAGTTTGGCCGATGTTGATGTCACCGAGCTCACAGC
TCCAGAGGATTTGAGGGTGGAAAAGGCAATCCAAGCAGAAGTTGCTGTGCACCGAAAAAAACTAACAGACATCGGCAATA
AACTGCAAAGTAAGCTTGTGGGCCTAAGCTATTGCAATCATGTGTTTACAGGACTTTTATCTGACATTCCCCAAGAGCTT
CGAGAAGAGAAGGAAGCCTGTGAGGAACTTCTTCGTCAACTGAGATTACGCAACACCGGCCCAGCTACAGCGGATGACTG
GAATCCAACCCATCGCTACAGGTTGCGTGGCATCATAGTTTCTAGCGGCACATTCTACATGTGCCGGCTAAAGGCAGATA
CTGATGATGAAGTGCTCATGAATGGGGCCGATCAGTGGTGGCGGATCTCCTCCTCCGCATCTGTCTCGGAACCTGTGCGC
ATTGAGGTAGGCTTTTTTTCTTTTTCTTCGTTCCCCCCTTGCGACTTCAAACTGAGCAGTCGTACAGAAAACATCGATAG
AGATGGCACAACAAGCAGCTTTCAGGGATAATAACAGGCCAATTGTTGTCTATGCAAATGATGCCGCGATAAATGAGACT
CTGGAACCATTGTCTGATTCGTTACGAACATTTGTTCGCTTTGATAACCGCTTCTTTAAGCAGGAGCTGGTTGGTGAAGG
ACCGCGCGAAAAGAAGCGAATGCCAACCGAGCCACCCACATCGCCATCTAAGCGACAACAACGGTCTAACAGCATTGATT
CGATGGCGACAAACAAAGCGTCCGTGGATGAATTGTCTGACCGTGACATGAGCGACGTACTGCTTGTTGCGGGGCGCTTC
GTTGTTTCCGAAGGTTTTGACGATGTACTTGTTGAGAAAGATGGCGAGGGATATGGAGACAGTACGGCCAACGGAACTCC
CCAGGATGTCCAAAGAACGGATAAAGAGGGTTGCCTAGGAACAGAGATGGTTCAACTGGCCATAAGTCGGCCAGGCGCAC
AGACACCAGCAGGTGTGGCTGGAATGGACGGAAATGAGACGCGACTTGGCACTGAAAACGATGGTGTCAACGGTAAAGAA
GATGGTGCCGATGATAAATGCAACACTTCTCTCCGGCAACGACAGTCAAATGAAAACATGGCACATGACAAAGTTAGTTT
GTTGGCTGATTGGGAATATCCCGAAGGTCGTTATGTGGGGCCTCCAGATGGCACCAAGGAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62