GenePrediction:GLEAN_1604 Details

Name: GLEAN_1604
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:906500..912315 (+ strand)
Length: 5816
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:906500..906553 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_82:906641..907149 (+ strand)
Length: 509
Type: CDS
Source: GLEAN
Position: GCSC_82:907480..907786 (+ strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_82:908601..908627 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_82:908784..908822 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_82:908891..908913 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_82:908975..909321 (+ strand)
Length: 347
Type: CDS
Source: GLEAN
Position: GCSC_82:909878..909952 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_82:910022..910091 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_82:910155..910650 (+ strand)
Length: 496
Type: CDS
Source: GLEAN
Position: GCSC_82:911561..911852 (+ strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_82:911900..912315 (+ strand)
Length: 416
>GLEAN_1604 class=GenePrediction position=GCSC_82:906500..912315 (+ strand)
ATGGCATCGAAGGTAGTCTCGAAAGTCGTTGGGGGGGTGATGAGCATCAACGAAGTGAGTTGTATCGGCGATTGCACTTC
TGTCAAAGAGGATTTGCATGTTCCGTTTTAGCCACATTCTAACCAGCTTTCTCTCTACTAGAAACAAACGCTGCAATCAA
AAGGGATATGGGAGGCTTTGCGCCGCCTCACAGTAATTGACGAGAACCGGAGCAACGGCGTGCCCTTAAATCCTTACTTC
CGCAATCCCACGCCTGGTGCACTGGACCCCCTGAGCTACGACGATCCTATCACTTTGCCCGCTGGTGACATTGCTGGCAA
CCCGTACTGGAAACGTGACGCCCGCCGGAACTATCCACGCCTCAGCGTAGTGAGCCAAGCGGACGTTGTGGCCCTTCTGA
CTGTCGGCAGCGCTGCAGCGCCAAAGACTGACCTTGTTGGGGCTGCTGGCGCACAGGCGCTTGTAGCAGCTGCCGAAGAG
GGCCAGACCAAAGGGTTGGGAGGACACCTGGCTGCCAAGCCACCTGTTGACGCTATCAAGGACTTACTTGTTGATGGCCT
ACCCCCTACCCCCAGTGGGCAGAGCCTGGCAAGTGGCTCGTGGGACGTTCATAAGTACAAGCTGACAGCGGAGCCGTCGT
ATTCGGAAGGGTATGCTCTTCAAACTCATTCAACAGACGTACGTTCTATTTACTAATGGTCTCAATAGTTATCCCTGCCG
GTCGTTTCAATGAAGATGTGAGATAATACGCGCAGTATCTATATCGTATATAGTTGCCACGGAAGATGGGATATCGCTGG
GAACTTGAGAATGTGTGAAGTGCTGTGTCTTTCGTCCTTCTATCTTGACCTCCCTGATATGGGCACCGTCAGCATTGCAC
TGCGATAATTTGAAGAAACTCCCATCTTTGAAATACGGCAAACGCTACCGACCCACAAACTTGCAAACTCGCCCATACCG
TCACAGTCCCTTATGGGTAGTGAGACGTTTGTGTTTGGATTTCCTTACAAGGCCGCTTTTGAGTCGAAGTCATCGTGTAT
TAGCTACAGTGTCGGTGTCTTTTCCGATGGCACTTTAGCCGGAACGGAGGCTGCTGCTGTGTTCGCCGTTTGTAATGATG
GTAATTGTTGCAAAGGAAACGGCGACGACGAAGATCCTAAGATTGTCGACTCGCCCGTGGCTTTCTCCACTATTCGTGCC
TTTCCGCTCGCTCGCTTAACGCGATTGTCGAAATCGGTAACGGCCTCATCAGTGTTCCCTACCGACAAAGTCCCGGGCTC
TATCAATGTATACAACGCCCGTACATTCTTCTGTAGGCGTGTGTTGTGTGGCAGATAGGACAAATGTCGAAAGGTGCTTC
GATACACGCGGTCTTGTGGCTTTTCCAAACGATTTGCCCAGACAACTGTCTTGCCGTAAAGGCGACCGCTCTCGAAAAAC
TTTTTGAACCCCGTCTCCAGGCCTAACGTGCGGCCCTCGTTCTGCCCTGCTTGATTCCCATCGTCTGTGCCTTGTTGGTA
TCCTTCTAGATAATAATGATCCTCTAGATGTAGAATTTCTTCAAGCGGGTCGGCGGCCATTTTCAAATCTCGATTTTATA
GCCTTAGTAGACGCATACGGAGTATATGTTGGTTTTTATTCAGCAAATATAACTCCGTACTTTGGGCATGTTACGTCGTA
CGTATTATTCGCACTCTAATATATGGAGTACCGAGTAATATAACTCGTAAAGTAGCTTACTCCGTAGTGGGGCACTAATT
GCGCGTTATGTGAACCCCTCTCTTCCCCTCGTCTTATTATGTATGATGACTCCTTGATATAGAGTAGTAAGCACTTGAAA
TTTTCCACTGGATTGTTCGCATTACACCTCACAACTGCGACATACTTTCACCAGTCTGATATTCTATCCACACTCTTCCC
GAACTATAAGCTACCTCAAGACTGACCAGAAAGAGCCCCTTTTCATGGCTACCAACGATACAATAAGACCCGTGAAGGGT
AAAAAGAACGTTTTGATCACGAGTGCGGTTCGTCTACCCAGTCCCACTGACAGTTCCATTGCTGAAGCATGCTGTTGCTA
ATCGTGAATTAAATTTAATAGCTGCCATACGTCAACAATGTCCCTCATGTTCGTCCTCCAAGCCCACGGCTTGTGTTTGC
AGGAAAAAAGCCAATGAAGCACAAGGAGATAACAGTGTATGCTGATTAAATTAACTCGTCGCAGCTGGGAAATATCGTTG
GATCTACCTTATCCGCGGACTGTTTCTCTCGCTATTCAAAACAGCGTGGGAACCCCACTCTGTATATCTGTGGTACTGAC
GAGGTGAGCTCATCCGGCGCTTTTTTTTCGGAAGCCTTTGTAGAACAGTAATGACTAACATTAGTACTTAGTACGGAACC
GCAACAGAGACCAAGTATGCCAATTTCTGTCCCTGCCGAGAGTAGCTTGATGCTGATACTTCTCTTTTTGTGTAGGGCGC
TGGAAGTTGGCATGAGCCCTCGAGAATTGTGCGACAAATTTCACAAATTACACAAGCAAATATACGACGATTTCGATATC
AAGTTCGACTACTTCGGCCGTACGAGTACCGATAAGCACACTGAAGTCGTCCAGGATGTCTTCTTGAAGCTGTGGGAAAA
AAAGTGGCTCGAGGAGCGTGTCACCACCCAACCATTCTGCGAAGGGCACAATGCTTTTCTCGGTAGGACTTGCACTTCTT
ATACTATGTACCAAATGACCCTGCTGACGAGTGATTTTCAGCCGACCGATTTGTCGAAGGAACCTGTCCTCGTTGTGGAT
ATGACGACGCTCGCGGAGATCAGTGTGATCAATGCGGCAACCTTCTAGACCCGTTTGAACTGGTACGTTGTATACGGATA
TCTATTTCTGTCTTGGAGCAGTATGGGGGGTTTTGACACGCAAGTAGATCAACCCTCGCTGCAAGGTCTGCAAAGTCAAT
AAAGCGCCTGTTCCCCGCGATACCAAACACATCTTTCTTGCTCTAGATAAGTTGCAAAACAAGATTGAAGACTGGTTTTT
GAAAGCCAGCAAAGATGGCAACTGGTCGCCCAACTCCATCGCAATCACTAAGTCATGGCTTGACAAGGGTTTGGAGGGCC
GGTCTATTACGCGCGATTTGAGCTGGGGCGTGCCAGTACCTCTCCCTGGCTATGAAGGGAAAGTAATTTATGTCTGGTAA
GTATCTTCGATTCTTCTTCTGTACTCGCAGTCGCGACTATAACGATGGTACTGATGTTAACACTGCCGCAGGTTTGATGT
TCGTACATTCTATTGGTCTACAAATTTTGTACGTCAGCTTCTGACTGTTGTTTAGGCCTGTATCGGTTACCCATCCATAA
CAGCTTGCTATACAAAAGACTGGACGGACTGGTGGAAAGCGGACGATGTAGAACTTTATCAGTTTATGGGCAAGGACAAC
ACGCCATTCCATGGTAAGACTCTCCATCATCCTTCCGTTACGAGCCATTTGTAATAACTTATCGTCTCAACCCCTCTATT
AGCCGTCATCTTTCCAGCTTGCGAAATTGGCACGGGAGACAACTGGACCATGGTCCACAACATTTCGACGACGTGAGTCA
CAGATTAATTCTCATCCCGATCACATTTGTTCGCGCTGACCCTATGAATATACAGGGAGTATCTTAATTACGAAGGAACA
AAATTCTCAAAATCTCGGTCTATAGGCGTCTTTGGTGATCAGGCCAAGGATACTGGCATTCCGACGTCTGTTTTCCGCTA
CTATCTACTCAGCTCAAGACCGGAGCACAGTGACACGCAGTTCGAATGGAGTTCATTCGTTCTGGCGAACAACTCCATCC
TGCTTGCCAATATAGGCAATTTCATCAACAGAATAGTGAAGTTCGTCAACGCCAAATTTGATGGGATCGTGCCGGAATAT
TCGCCAACACTCACTGACGATAATTTTGATTTCCCTGGTTGGATTGGCGATGTGCAAAACCTCCTCGATGAGTACATCAG
CGAGATGGATTTTGTCCACCTACGCAGCGGGGTGGAGAAGGCAACTGCCATATCTAGCCAAGGTAATACCCTGTTGCAGT
ATCGGCTGGATAATTCTTGTCTAGAGAAAGAGCCTGAAAGGACCAAGACCGTCATTGGATATGCTCTGTCTGTATGCTCA
CTGTTGGCATCGGTTCTCTCACCGTTCATTCCGGCGACTTCGGAGGCTATCTCGACTCAGTTGAATCTCCCTTTGCAATT
GATCACGGACAAATTTGACCCATATAGTGTCAAGCCTGGCCACAAGATAGGCAAACCTGCCTATCTGTTTTCTCGTATTG
ACGACAAAAAGGTGGCCGAATGGAAAGAGAAATTTGGCGGTTCAGCTGAGACCAATGCTGCGGAAGCTGAAGCTAAGAAG
AAAAAGCAAGAAGACAAGGAAAGGAAGAAGGCGAAGAAAGCTGCTGCCAAGGCGGCGGCTCTGGCAGGATCCGCAACGGA
AACATCCGCCTCAACGATGGAACCAGAGACAAAATCATTACCGGTGCGGGAAAATTCAGAATAGACGTGGCGCAGATTCT
AAAGAAGTACACCGGGCACAAACCGAGGGAGGCTGGGACTGAAGGTGAGGAAGGGAACAGTTCAAATATACCGATATTTT
TGGGAGTTGTCTGGCAATATTGATTTGTGTGCAAGATATCAAGTAGGCTTACGCCATAGTTCTACAAAACACTGGACGCA
GTAAATGATACTGGCCCTTGCAGCACGGTTAGAAACTTGGTGATGCTGAGTATGGAGTATATTTAGTAAATGTTGGTCCT
GAAACTACGGAGTACGGAGTATTACACGGTACTCCGTATTCTGTATTGAAAGAGGTGGGACCCACAATATGTAGCAATCC
GACAAGATTGCGAAATACTCCGTAGGTGGGAAAGCTTTTAATACCCACATTCACAACTGCACTGGACTGAAAAACATACC
CATGCCATTACCATCTACACCTGTCGCCATATTCACCACATCGCTCTGTGCCATTCTTTTTGTGACTGCTTTTCTTTACC
ATGGATATTCGCCCTTTACAGTCATCGGACCTACCGTTGATTCAGCACGCGAACCTAGAGAATCTCCCAGAGAACTACTT
GCTCAAATACTATTTGTACCATGCCATGACCTGGCCACAGCTGAGCTATGTCGCCGTCGACGTTAGCCGCCCAGCCAAGA
CACCATACGACCACCCCAAGATTGTCGGCTACGTCCTGGCCAAGATAGAGGAGGAACCGGCGGATGGCGTGCAGCACGGC
CACATTACCAGCATCAGTGTGATGCGTACGCATCGCCGCCTCGGCATCGCCGAGAAACTGATGCGACAAGCCCGTAAGAT
TCCAACACACGTAATACAGAGGAAAAACTGACTTTGAAAGAGCTCGCAATGGTCGAGACATTCGGTGCCCGTTATGTCAG
CCTTCATGTGCGCGTGTCCAACTTCGCTGCCATACACCTATACTGCCAAACCCTTGGATTTCGCAACGATAAGACTGAAC
TTAAATACTACGCTGATGGAGAGGATGCGTATAGTATGAGACTAGATTTAGACGACTTGCGGCAACAGCTGGAAGGCGAG
ATTTCTGAAAAGAAGGAGAAGCGGGAGAAGAAGGTGGGAGATAACGACGCCGAGAAGAAAGAGGTTGACGGAGCGTTCTC
CGACGAAGGGGAGCCGGTTGGAGAAGCTGGCCATGCGGTCCACACAAGTCGGGAACGCAAGGTCAAAGTTAAAGTCGGCC
GAGCACTTGGCGTTGGCGAACTGGTGGAACGGGTTGAAGCAAAATCGGCGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62