GenePrediction:GLEAN_1605 Details

Name: GLEAN_1605
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:918328..920818 (+ strand)
Length: 2491
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:918328..918353 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_82:918725..918734 (+ strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_82:919439..919952 (+ strand)
Length: 514
Type: CDS
Source: GLEAN
Position: GCSC_82:920200..920250 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_82:920472..920555 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_82:920619..920818 (+ strand)
Length: 200
>GLEAN_1605 class=GenePrediction position=GCSC_82:918328..920818 (+ strand)
ATGGCGAACAAGGCTTTTTTTGATAAGTGCGCTCTCAATAAAAATACTTAGCCTGGGAGTTCAGCCTGGTCTCTTTGAAA
TCCATAGATAGCCTGTTGAAGACTCATTAATCATATTCGATAGTGAATGCATATGTATGGTGTTTCACTCTAAAAGTAGC
GCCAATATTCCAGTTCGCTCCTTCCCTTTTTGTTGCACGAGTGCATTTCCTTGACTTTCTCGGTCCTTCTTTTGTCTTGC
AGAGTCGCTACTACCTGTTCTCATCACCGATTCAATTCGATTTTGTATTTACTGAAAAAAAAAACCCCTTCTCTGCTCCT
TTCAACTTTCACCTTCTTCCACCTTCTTCAACTTACCCTGCCTGGAAACAAATGCTTAATAAAAAATAGCAGCACAGCCA
ATACGAGGTAGGTTTTGCTTGACCTTTCTTTCATGTTCTCCATTGTTATCCTGCATCTCTGCATTTTTTTTATTCACAAG
CATACCTTGCAAAGCTCACTAATGCGTGATAACTAAAGATTCCATCAACTTTCAAGTTGCCAAACGAGACGCAGTATACA
ATGTCGTGGGATGAAGCTGGCCATGGGCCTGGCACGGCTGTCGATCAAGGAGAACAGTCTTGCTATAACTGTGGCGAGAG
CGGGTATGATCGTCAACCTTTCGCCGTTGCTTATTTTCAAATCCGTAACTAATGCTGTCTGTAACAGTCACAGCAAATTC
GACTGCCCTGTACACCGCCAATTCAGTGGACAGTGCAATTCTTGTGGCAAGGACGGACATATGTCAAAGTACTGTCCCGA
CTCCGGCCCCATGGTGTGCCACCGATGCAAAAAGGAAGGGCACATGTCGAAGGATTGTGAAATGCCCGTTATTTGTCCGC
GTTGCAATGAAAATAACCATGTTCAGGACTGCCCCTTGCCTATGCTTTGCCGGGTATGCGAGCAGGAGGGACATCTGGCC
AAAGATTGCCCGGCTGCTCCGCCTCGCGTTTGCCATAATTGCCGAGAGGAAGGTGAATAAGATAACCATTCAGTTCCCTT
TTCAATTCATTGGACCGATACAATCTAACTGGGAAGGCCATGATGCTTCCTCTTGTGAAGCCCCTCGAAAGGTCGATCGT
GATGCCATCCCGGACCATTCTCCCGAAGAAGCTCTGGAATATCTCATCCAAGCTATCGGGGAGAAGGACCTTGGTGATGT
TAAAATCGCTGTCCAGATGTATGTGAAGGCACTTCCAAAAACCACATATGTTGGCCTTGAAAAGCTGCTGCGAGCCAAAA
ACATACCCCTCTTCCTCATTGGGGTGGAGAAGATAGACATGGCGTCAACCTTCACCAATATGGACTTTCAAGGAAATTTG
GACAAACAGTTTAGCGTCACGTATCGCTTCCAAAGTCGTCCGTCTCGGCCCCGCGAGAAAAACATCTGGCCAACCAGTGC
TGAGGAGAATTTGGCTCGACTTGCCAACGGAGGGGAGCCTGTGCCTCGTGGTATTCCCCTGTGCTCTAACTGCAAAGAAC
TTGGCCATATCAGTCGCAATTGCCCGATTGAAAAGCAGGAAATACTCGACAAGGCTACAGTGACCTGCTACAACTGCGGA
GAAACAGGCCATCGTGTTCGCGACTGTAGGCAGTCCCCGAGTATGAAACCTCCTAATTTCAAAGAGACAACCTAACTGTA
ACGATAGGCAAGACGCCTAGAACGGACAAATTCGCGTGCCGGAACTGCGGGTCAGCATCTTGATTCTTTACTTTCCACAT
ATAAGGATAGGGCTGATTTTTACTAGGCAAAGCGGACACTCTGGCAAAGTTTGTATGCACGCCCAGTGTTCCTTCACCGA
ATGGTGAAAGTGTGCTTGCTAATATGCCTTAGGCCCAGAGCCGAGGTCGGCCGAGAACGTCGAATACCGGAAGTGCGGTG
AAAGTAAGATGCGAGATCCTCGTTGTATATATAATGGGACGTCATGCTAATACGGTTGAATCATACAGCGGGGCATTTTT
CCAAAGACTGCCCTCAAGGTGGTGGCGACAACACTTGCCGAAATTGTGGCCAGGAGGGCCATATGGCACGCGATTGTGCT
GAGCCCCGGAAGGTCGTCTGTCGCAACTGCGACCAAGAAGGACATGTCTCTCGTGACTGCCCAGAACCTCGGAATGTATC
CAAGATGCAATGCCACAATTGCGATGAGTACGGGCACATATCTAAGGACTGCCAGGTGCCGCGAAACAGTATGTGTTGTC
TACATCGGCTACTATTTGTTTGGCAACTAATGCGTGCTTTGTACGTCACAGTGGATCGAACACGGAACTTCAACGGCCAA
CAGACGGACCATTTCCGTCCAGCTTGCAAAAACGAAGCATCCATGGAAGCGGGCGGTGATGCTATGATGGCTAGCAATAG
CTTCAGCGGGCACAATTTTGGCTGCGAAAGGGACAATGCGCCCGATGTGACTGATGCTACTAATGTGGTTGCTGGTGATG
GTGTATGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62