GenePrediction:GLEAN_160 Details

Name: GLEAN_160
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1101120..1101850 (+ strand)
Length: 731
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1101120..1101122 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_179:1101203..1101850 (+ strand)
Length: 648
>GLEAN_160 class=GenePrediction position=GCSC_179:1101120..1101850 (+ strand)
ATGGTAGGTCTCTCTTCAAGCCTCCAGCTTCATGTACCGATTGTGCCTTTATGTTTATATACTAACACGTGTCTGCCTTC
TAGGCTCCGACAGCGCCTACGCAGGAACCCCGGATGAGCCACCGGGCCAAGGCTCTCGCCCGGCTGGCCGACCCAACTCT
GCCTCGCAAGGTGCACCGCGATAACAACGCTGTGACTGATGCCTTTCTACACTCGAAGCGCGACAAACAAACCATCCGCA
AGTCTGTGTTCCGTGCGCGCGTGGCCGATAGCGCAGCGGCCGCCCGCAGCAGCCGCACCGGGGCTACGCGAGCGCTTCGG
CGTCGTCGGCCGTCCAAGAAGTTGGTGGCCACGCTGCAGTCGCTTGCCGATGCCCTCCCGGAGTTAGAAGAGGGAGGTGG
CAAGGGTGCCGAGGACGAACACAGTGGGGGGGCCTCGCGGCGACGGACGGCGAGCCTGCACAGTCGGCCGGGCGCATTGA
AGCGCAAAGAAAAGGTGGTCAAGGCTGAGATGGCACGCTTCGGTACCAACCTGGCACAGCTGACAGCCACACACGAGGAT
TCCATGGCCGTCTCGCTGCCGTCCGCTTCTGACGACGGCGCTGCGAGTACCGTTGACGACGTCTCTGCCGCCCCAACGAC
AAAAGCCTCGACGGCCAATCGCTGGGCCCTACTACGCACCTTCATTTCATCTACCATGGAGCAGAGCCCGGCTTTTGAAA
ACCAGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62