GenePrediction:GLEAN_161 Details

Name: GLEAN_161
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1104649..1105702 (+ strand)
Length: 1054
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1104649..1104788 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_179:1105034..1105320 (+ strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_179:1105632..1105702 (+ strand)
Length: 71
>GLEAN_161 class=GenePrediction position=GCSC_179:1104649..1105702 (+ strand)
ATGGATTTATTGTGGGGAGTGGCCAGCTCAGTTTCAAGAGGCCGCCACCTCACAGGCAGGCCGGTCACAGGACTACAGCC
TAACCCGCCTAATACGTTGTACGGAGTTCGTGTACGCTTATCGGCCCTGCGGGGTAGGAGGTATGCCCTAGGCTCGCTGT
CGTCACTGAAGGCGCCGCCCTGTAGCCCCACACAGCTTGAGGGGCGACTCCAAGTCAGCAGCATGACAGCCAGCAAGGAA
GACGCAATGCCCGCTGATCGGCTATCTGTGCGAATTGTCGCGCTTGCTGAACAAAGCGATCAGTTGTGTAGCTAGCTGAT
TCCTTGAGATATGGCAGATGCATGGCTAACTGCTCAGTTAGTCTGGTAAGTGTCTCCCCCGACAGGGTACACAAGCTGGC
CTCGCGGTACGATCTCAGCGTCGATTCGTCCACCTTTGAGACGCGGGTAGCCGAAGTCTCGTCGGACGAGCCGCTGCTGT
TCGAAGCCATCCTTACCCTCTCCCTTGTGCATCTCTGCAAACCCATTGCCAGGTCTTGTCGTGAATCTGCGGAGTTCCAC
CACAGGCACTGCATCGCGCTACTCATCGGTCTCGACAAGGGGCACCAGCTGCTCGAAGATGGCGTAGCTCTTGCGGCAGC
CTGCCCTCTGCGGGCGTACGAGTTCATCGACGGTGAGTACGTGCATATTCGGAAGCTGAAGCGGTTGGGCCAACGGAACT
TAAAGAAGCTGAGATTGCCCAGAGAATGTCGGCCCCGATCGCCTTCTTCAGGGGACATTCTCACTCGCATCACATCAGAG
CATCCCGAATGTCCTTGCCGTCAATGCCTTGTTTGCCGCCGGATTCTTCAAGTATCTACTAAGAAGATAGAACCTTCAGC
CTCTTTGCCAAATGCGTGTCCAGAACTGATCTCGAAGCCGTCCCCTTAATCACAAGTTTCCGGTCCGGCCATACCTATCC
AAATGCTATCACCTTGATTCTAGGCCAGATTATCAATGCCGAGTTCAGTGCTACCATTGAGCTGCAGAATCTTGTCGCAC
TTTGTCTTAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62